Mutagenetix > Incidental Mutations

Incidental Mutation 'R4450:Rangrf'

328939

Institutional Source

Beutler Lab

Gene Symbol

Rangrf

Ensembl Gene

ENSMUSG00000032892

Gene Name

RAN guanine nucleotide release factor

Synonyms

Rangnrf, Mog1, 2400006H24Rik

MMRRC Submission

041711-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.244) question?

Stock #

R4450 (G1)

Quality Score

220

Status

Validated

Chromosome

Chromosomal Location

68972484-68975185 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

A to T at 68975184 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000099666 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018884] [ENSMUST00000038644] [ENSMUST00000102606]

Predicted Effect

probably benign
Transcript: ENSMUST00000018884

SMART Domains

Protein: ENSMUSP00000018884
Gene: ENSMUSG00000018740

Domain	Start	End	E-Value	Type
Pfam:Mito_carr	1	90	4.5e-20	PFAM
Pfam:Mito_carr	98	193	2.2e-16	PFAM
Pfam:Mito_carr	197	295	6.8e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000038644

SMART Domains

Protein: ENSMUSP00000038485
Gene: ENSMUSG00000032892

Domain	Start	End	E-Value	Type
Pfam:Mog1	7	145	1.3e-41	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000102606

SMART Domains

Protein: ENSMUSP00000099666
Gene: ENSMUSG00000018740

Domain	Start	End	E-Value	Type
Pfam:Mito_carr	1	92	7.9e-17	PFAM
Pfam:Mito_carr	98	197	1.2e-16	PFAM
Pfam:Mito_carr	202	299	8.6e-18	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132093

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133099

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136520

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138362

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143444

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144271

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150017

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156178

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

98% (43/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has been shown to function as a guanine nucleotide release factor in mouse and to regulate the expression and function of the Nav1.5 cardiac sodium channel in human. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3930402G23Rik	T	A	8: 10,926,129		noncoding transcript	Het
Acsl6	A	G	11: 54,328,403	D278G	probably damaging	Het
Adamdec1	C	T	14: 68,573,119	R196Q	probably benign	Het
Akap13	T	A	7: 75,742,760	F2450L	probably damaging	Het
Alg11	C	A	8: 22,068,079	A469E	probably benign	Het
Angel1	A	T	12: 86,721,924	Y262N	probably damaging	Het
Arhgef18	A	G	8: 3,437,097	E272G	probably damaging	Het
Bpifb6	A	G	2: 153,906,768	E228G	possibly damaging	Het
Brca2	T	G	5: 150,536,053	D264E	probably damaging	Het
Cdca4	T	C	12: 112,821,658	N150S	probably benign	Het
Cep162	T	C	9: 87,225,808	S510G	probably damaging	Het
Cldn12	T	C	5: 5,508,398	T10A	probably damaging	Het
Clip2	C	T	5: 134,502,953	G631D	possibly damaging	Het
Col19a1	T	A	1: 24,322,035	T625S	probably damaging	Het
Col6a5	C	T	9: 105,904,521	G1635D	unknown	Het
Dcp1b	A	G	6: 119,206,476	T175A	probably benign	Het
Eln	C	T	5: 134,725,781		probably benign	Het
Galnt2	A	G	8: 124,295,377	D14G	probably benign	Het
Gm9894	T	A	13: 67,765,080		noncoding transcript	Het
Herc2	T	C	7: 56,227,892	L4569P	probably damaging	Het
Hrasls	C	T	16: 29,228,224	T165M	possibly damaging	Het
Iqcm	T	C	8: 75,629,766	S176P	probably damaging	Het
Klhl42	G	A	6: 147,091,671	G47D	probably benign	Het
Lmo2	T	C	2: 103,981,062	Y147H	probably damaging	Het
Lzts2	A	T	19: 45,023,593	K154*	probably null	Het
Map4k3	C	T	17: 80,603,982		probably null	Het
Mlc1	A	G	15: 88,963,490	F285S	probably benign	Het
Myo5a	T	A	9: 75,167,176	M789K	probably benign	Het
Nbeal1	T	A	1: 60,267,774	S319T	probably damaging	Het
Nsun4	A	T	4: 116,051,256	Y702*	probably null	Het
Olfr917	A	T	9: 38,665,754	V30E	probably benign	Het
Olfr954	G	A	9: 39,462,032	M200I	probably benign	Het
Osbpl5	T	A	7: 143,694,906	T640S	probably benign	Het
Rnpc3	T	C	3: 113,611,137		probably benign	Het
Ros1	C	T	10: 52,077,942	G1867D	probably damaging	Het
Slc11a1	C	A	1: 74,385,535		probably benign	Het
Slc15a4	A	G	5: 127,604,536		probably null	Het
Speer3	C	G	5: 13,796,380	A238G	possibly damaging	Het
Syt6	A	G	3: 103,585,645	H156R	probably benign	Het
Tln2	C	T	9: 67,344,065		probably null	Het
Trim58	T	C	11: 58,651,365	W384R	probably benign	Het
Wwc2	A	G	8: 47,868,667	Y471H	unknown	Het

Other mutations in Rangrf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02431:Rangrf	APN	11	68972739	missense	probably benign	0.00
R0611:Rangrf	UTSW	11	68972692	missense	probably benign	0.13
R4850:Rangrf	UTSW	11	68973640	critical splice donor site	probably null
R6341:Rangrf	UTSW	11	68972712	missense	probably benign	0.23
R6453:Rangrf	UTSW	11	68973552	missense	probably damaging	1.00
R6526:Rangrf	UTSW	11	68973688	missense	probably damaging	1.00
R7755:Rangrf	UTSW	11	68973714	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GCAATGCTAGGGATTGAGCC -3'
(R):5'- ATGGAGAGACGTTCATGGCC -3'

Sequencing Primer
(F):5'- AGGGGCCTCTACCATTAGATTC -3'
(R):5'- TCTATTCCATGGGGGCTGCAC -3'

Posted On

2015-07-21