Incidental Mutation 'R4450:Hrasls'
ID328945
Institutional Source Beutler Lab
Gene Symbol Hrasls
Ensembl Gene ENSMUSG00000022525
Gene NameHRAS-like suppressor
Synonyms2810012B06Rik, A-C1
MMRRC Submission 041711-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4450 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location29209695-29230531 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 29228224 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 165 (T165M)
Ref Sequence ENSEMBL: ENSMUSP00000087257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075806] [ENSMUST00000089824] [ENSMUST00000142681] [ENSMUST00000143373] [ENSMUST00000162747]
Predicted Effect probably benign
Transcript: ENSMUST00000075806
SMART Domains Protein: ENSMUSP00000075204
Gene: ENSMUSG00000048939

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 142 4.1e-31 PFAM
Cation_ATPase_N 163 223 8.78e0 SMART
Pfam:E1-E2_ATPase 228 475 1.5e-35 PFAM
Pfam:Hydrolase 480 759 2.7e-11 PFAM
Pfam:HAD 483 857 1.1e-28 PFAM
Pfam:Cation_ATPase 564 638 1.3e-6 PFAM
transmembrane domain 901 923 N/A INTRINSIC
transmembrane domain 933 950 N/A INTRINSIC
transmembrane domain 971 993 N/A INTRINSIC
transmembrane domain 1042 1061 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1129 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000089824
AA Change: T165M

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000087257
Gene: ENSMUSG00000022525
AA Change: T165M

DomainStartEndE-ValueType
Pfam:LRAT 8 132 6.1e-44 PFAM
transmembrane domain 140 159 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142681
SMART Domains Protein: ENSMUSP00000118627
Gene: ENSMUSG00000048939

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 142 7.5e-25 PFAM
Cation_ATPase_N 163 223 8.78e0 SMART
Pfam:E1-E2_ATPase 229 475 1e-36 PFAM
Pfam:Hydrolase 480 860 5.9e-16 PFAM
Pfam:HAD 483 857 4e-27 PFAM
Pfam:Hydrolase_like2 565 638 3.7e-8 PFAM
transmembrane domain 901 923 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143373
SMART Domains Protein: ENSMUSP00000121208
Gene: ENSMUSG00000048939

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 142 1e-24 PFAM
Pfam:E1-E2_ATPase 196 430 3.2e-34 PFAM
Pfam:Hydrolase 435 815 9.1e-16 PFAM
Pfam:HAD 438 812 6.2e-27 PFAM
Pfam:Hydrolase_like2 520 593 4.8e-8 PFAM
transmembrane domain 856 878 N/A INTRINSIC
transmembrane domain 888 905 N/A INTRINSIC
transmembrane domain 926 948 N/A INTRINSIC
transmembrane domain 997 1016 N/A INTRINSIC
transmembrane domain 1025 1047 N/A INTRINSIC
transmembrane domain 1062 1084 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160794
Predicted Effect possibly damaging
Transcript: ENSMUST00000162747
AA Change: T165M

PolyPhen 2 Score 0.671 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123809
Gene: ENSMUSG00000022525
AA Change: T165M

DomainStartEndE-ValueType
Pfam:LRAT 13 132 7.5e-41 PFAM
transmembrane domain 140 159 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
Acsl6 A G 11: 54,328,403 D278G probably damaging Het
Adamdec1 C T 14: 68,573,119 R196Q probably benign Het
Akap13 T A 7: 75,742,760 F2450L probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Angel1 A T 12: 86,721,924 Y262N probably damaging Het
Arhgef18 A G 8: 3,437,097 E272G probably damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Brca2 T G 5: 150,536,053 D264E probably damaging Het
Cdca4 T C 12: 112,821,658 N150S probably benign Het
Cep162 T C 9: 87,225,808 S510G probably damaging Het
Cldn12 T C 5: 5,508,398 T10A probably damaging Het
Clip2 C T 5: 134,502,953 G631D possibly damaging Het
Col19a1 T A 1: 24,322,035 T625S probably damaging Het
Col6a5 C T 9: 105,904,521 G1635D unknown Het
Dcp1b A G 6: 119,206,476 T175A probably benign Het
Eln C T 5: 134,725,781 probably benign Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm9894 T A 13: 67,765,080 noncoding transcript Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Klhl42 G A 6: 147,091,671 G47D probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lzts2 A T 19: 45,023,593 K154* probably null Het
Map4k3 C T 17: 80,603,982 probably null Het
Mlc1 A G 15: 88,963,490 F285S probably benign Het
Myo5a T A 9: 75,167,176 M789K probably benign Het
Nbeal1 T A 1: 60,267,774 S319T probably damaging Het
Nsun4 A T 4: 116,051,256 Y702* probably null Het
Olfr917 A T 9: 38,665,754 V30E probably benign Het
Olfr954 G A 9: 39,462,032 M200I probably benign Het
Osbpl5 T A 7: 143,694,906 T640S probably benign Het
Rangrf A T 11: 68,975,184 probably benign Het
Rnpc3 T C 3: 113,611,137 probably benign Het
Ros1 C T 10: 52,077,942 G1867D probably damaging Het
Slc11a1 C A 1: 74,385,535 probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Syt6 A G 3: 103,585,645 H156R probably benign Het
Tln2 C T 9: 67,344,065 probably null Het
Trim58 T C 11: 58,651,365 W384R probably benign Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Other mutations in Hrasls
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0487:Hrasls UTSW 16 29220579 splice site probably null
R1437:Hrasls UTSW 16 29228170 missense possibly damaging 0.78
R1707:Hrasls UTSW 16 29228226 missense probably damaging 0.96
R1858:Hrasls UTSW 16 29217718 missense probably damaging 1.00
R4996:Hrasls UTSW 16 29217704 nonsense probably null
R5617:Hrasls UTSW 16 29220410 nonsense probably null
R5872:Hrasls UTSW 16 29220437 missense probably benign 0.27
R6157:Hrasls UTSW 16 29217749 missense possibly damaging 0.70
R7502:Hrasls UTSW 16 29228167 missense probably benign 0.00
R8237:Hrasls UTSW 16 29220354 missense probably benign
R8804:Hrasls UTSW 16 29220453 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TTAATGGAGCAAACCAAAGCTG -3'
(R):5'- TTTTGTTCAAGCTGCCACG -3'

Sequencing Primer
(F):5'- CTGCAAGTCAAAACTGCCATCTTTAG -3'
(R):5'- CACGGCAAATCTCTGCTAGTTGG -3'
Posted On2015-07-21