Incidental Mutation 'R4450:Lzts2'
ID328947
Institutional Source Beutler Lab
Gene Symbol Lzts2
Ensembl Gene ENSMUSG00000035342
Gene Nameleucine zipper, putative tumor suppressor 2
Synonyms
MMRRC Submission 041711-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R4450 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location45015176-45027104 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 45023593 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 154 (K154*)
Ref Sequence ENSEMBL: ENSMUSP00000137571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039016] [ENSMUST00000145391] [ENSMUST00000169459] [ENSMUST00000178087] [ENSMUST00000179108]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000038901
Predicted Effect probably null
Transcript: ENSMUST00000039016
AA Change: K154*
SMART Domains Protein: ENSMUSP00000045478
Gene: ENSMUSG00000035342
AA Change: K154*

DomainStartEndE-ValueType
low complexity region 99 105 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 242 265 N/A INTRINSIC
low complexity region 267 321 N/A INTRINSIC
low complexity region 375 407 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
Pfam:Fez1 441 639 4.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145391
SMART Domains Protein: ENSMUSP00000119002
Gene: ENSMUSG00000074818

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
PDZ 95 167 3.51e-19 SMART
PDZ 220 292 2.47e-14 SMART
low complexity region 319 344 N/A INTRINSIC
low complexity region 442 459 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
low complexity region 724 744 N/A INTRINSIC
low complexity region 768 809 N/A INTRINSIC
low complexity region 812 824 N/A INTRINSIC
PDZ 866 947 1.96e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169459
SMART Domains Protein: ENSMUSP00000133273
Gene: ENSMUSG00000074818

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
PDZ 95 167 3.51e-19 SMART
PDZ 220 292 2.47e-14 SMART
low complexity region 319 344 N/A INTRINSIC
low complexity region 442 459 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
low complexity region 724 744 N/A INTRINSIC
low complexity region 768 809 N/A INTRINSIC
low complexity region 812 824 N/A INTRINSIC
PDZ 866 947 1.96e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000178087
AA Change: K154*
SMART Domains Protein: ENSMUSP00000136405
Gene: ENSMUSG00000035342
AA Change: K154*

DomainStartEndE-ValueType
low complexity region 99 105 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 242 265 N/A INTRINSIC
low complexity region 267 321 N/A INTRINSIC
low complexity region 375 407 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
Pfam:Fez1 441 638 2.2e-66 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000179108
AA Change: K154*
SMART Domains Protein: ENSMUSP00000137571
Gene: ENSMUSG00000035342
AA Change: K154*

DomainStartEndE-ValueType
low complexity region 99 105 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 242 265 N/A INTRINSIC
low complexity region 267 321 N/A INTRINSIC
low complexity region 375 407 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
Pfam:Fez1 441 639 4.2e-82 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the leucine zipper tumor suppressor family of proteins, which function in transcription regulation and cell cycle control. This family member can repress beta-catenin-mediated transcriptional activation and is a negative regulator of the Wnt signaling pathway. It negatively regulates microtubule severing at centrosomes, and is necessary for central spindle formation and cytokinesis completion. It is implicated in cancer, where it may inhibit cell proliferation and decrease susceptibility to tumor development. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null mutation display defects in urinary tract development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
Acsl6 A G 11: 54,328,403 D278G probably damaging Het
Adamdec1 C T 14: 68,573,119 R196Q probably benign Het
Akap13 T A 7: 75,742,760 F2450L probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Angel1 A T 12: 86,721,924 Y262N probably damaging Het
Arhgef18 A G 8: 3,437,097 E272G probably damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Brca2 T G 5: 150,536,053 D264E probably damaging Het
Cdca4 T C 12: 112,821,658 N150S probably benign Het
Cep162 T C 9: 87,225,808 S510G probably damaging Het
Cldn12 T C 5: 5,508,398 T10A probably damaging Het
Clip2 C T 5: 134,502,953 G631D possibly damaging Het
Col19a1 T A 1: 24,322,035 T625S probably damaging Het
Col6a5 C T 9: 105,904,521 G1635D unknown Het
Dcp1b A G 6: 119,206,476 T175A probably benign Het
Eln C T 5: 134,725,781 probably benign Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm9894 T A 13: 67,765,080 noncoding transcript Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hrasls C T 16: 29,228,224 T165M possibly damaging Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Klhl42 G A 6: 147,091,671 G47D probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Map4k3 C T 17: 80,603,982 probably null Het
Mlc1 A G 15: 88,963,490 F285S probably benign Het
Myo5a T A 9: 75,167,176 M789K probably benign Het
Nbeal1 T A 1: 60,267,774 S319T probably damaging Het
Nsun4 A T 4: 116,051,256 Y702* probably null Het
Olfr917 A T 9: 38,665,754 V30E probably benign Het
Olfr954 G A 9: 39,462,032 M200I probably benign Het
Osbpl5 T A 7: 143,694,906 T640S probably benign Het
Rangrf A T 11: 68,975,184 probably benign Het
Rnpc3 T C 3: 113,611,137 probably benign Het
Ros1 C T 10: 52,077,942 G1867D probably damaging Het
Slc11a1 C A 1: 74,385,535 probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Syt6 A G 3: 103,585,645 H156R probably benign Het
Tln2 C T 9: 67,344,065 probably null Het
Trim58 T C 11: 58,651,365 W384R probably benign Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Other mutations in Lzts2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02115:Lzts2 APN 19 45026370 unclassified probably benign
R0053:Lzts2 UTSW 19 45026307 unclassified probably benign
R0135:Lzts2 UTSW 19 45026187 unclassified probably benign
R0433:Lzts2 UTSW 19 45021676 missense possibly damaging 0.87
R1079:Lzts2 UTSW 19 45023544 missense probably damaging 1.00
R1459:Lzts2 UTSW 19 45021454 missense probably damaging 1.00
R2869:Lzts2 UTSW 19 45024095 nonsense probably null
R2869:Lzts2 UTSW 19 45024095 nonsense probably null
R5806:Lzts2 UTSW 19 45026367 unclassified probably benign
R6958:Lzts2 UTSW 19 45024143 unclassified probably benign
R7598:Lzts2 UTSW 19 45023833 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGCTTGGTATGACACACC -3'
(R):5'- ACTGGCCCAACCACTCAGT -3'

Sequencing Primer
(F):5'- GTAGCTGTCTTTGAACACACCAG -3'
(R):5'- CACTCAGTGCCAAGGGTTTGTC -3'
Posted On2015-07-21