Incidental Mutation 'R4451:Cela3b'
ID328957
Institutional Source Beutler Lab
Gene Symbol Cela3b
Ensembl Gene ENSMUSG00000023433
Gene Namechymotrypsin-like elastase family, member 3B
Synonyms2310074F01Rik, Ela3b, Ela3, 0910001F22Rik
MMRRC Submission 041712-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R4451 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location137420999-137430540 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) G to A at 137421044 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102522]
Predicted Effect probably benign
Transcript: ENSMUST00000102522
SMART Domains Protein: ENSMUSP00000099581
Gene: ENSMUSG00000023433

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Tryp_SPc 27 262 8.81e-94 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134565
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Elastases form a subfamily of serine proteases that hydrolyze many proteins in addition to elastin. Humans have six elastase genes which encode the structurally similar proteins elastase 1, 2, 2A, 2B, 3A, and 3B. Unlike other elastases, elastase 3B has little elastolytic activity. Like most of the human elastases, elastase 3B is secreted from the pancreas as a zymogen and, like other serine proteases such as trypsin, chymotrypsin and kallikrein, it has a digestive function in the intestine. Elastase 3B preferentially cleaves proteins after alanine residues. Elastase 3B may also function in the intestinal transport and metabolism of cholesterol. Both elastase 3A and elastase 3B have been referred to as protease E and as elastase 1, and excretion of this protein in fecal material is frequently used as a measure of pancreatic function in clinical assays. [provided by RefSeq, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 A C 5: 62,749,170 F169V probably benign Het
Baiap2l1 T A 5: 144,278,552 Y381F probably damaging Het
Cdc27 A T 11: 104,517,395 M563K probably benign Het
Cyp2c29 A T 19: 39,290,826 D50V probably damaging Het
Dbpht2 A T 12: 74,299,032 noncoding transcript Het
Dnah9 T A 11: 65,881,641 Q3755L probably benign Het
Dnajc2 T C 5: 21,757,794 T588A possibly damaging Het
Dync2h1 T A 9: 6,983,477 R4022S probably benign Het
Gm20481 T G 17: 34,972,133 probably benign Het
Gm7347 A G 5: 26,055,006 I182T possibly damaging Het
Gns G A 10: 121,376,696 G188S probably damaging Het
Grm5 T G 7: 88,075,132 probably null Het
Gstm4 T C 3: 108,043,975 probably null Het
Il7r T A 15: 9,512,948 K158N probably benign Het
Irs1 T C 1: 82,289,028 Y489C probably benign Het
Kcns1 C T 2: 164,168,678 E54K possibly damaging Het
Klra5 T A 6: 129,908,834 R31* probably null Het
Krt13 T C 11: 100,118,001 T409A unknown Het
Lce1e C T 3: 92,707,660 G127S unknown Het
Mfsd14a T C 3: 116,662,478 M1V probably null Het
Micall2 T C 5: 139,707,097 E891G probably damaging Het
Mpeg1 A T 19: 12,463,232 K685* probably null Het
Nbea A G 3: 55,992,332 probably null Het
Nup155 A G 15: 8,150,882 M1148V probably benign Het
Olfr1033 T C 2: 86,041,959 S215P probably damaging Het
Olfr611 A G 7: 103,517,977 S136P probably damaging Het
Otof T A 5: 30,385,164 D695V possibly damaging Het
Ptf1a G T 2: 19,446,281 A141S possibly damaging Het
Pxmp2 A T 5: 110,277,665 V168E probably damaging Het
Rab11fip1 T C 8: 27,154,477 K427E probably damaging Het
Susd2 A G 10: 75,639,398 V526A probably damaging Het
Tbx2 T C 11: 85,840,817 S647P probably damaging Het
Tg A G 15: 66,766,147 T651A probably benign Het
Trim68 T A 7: 102,684,473 M1L probably damaging Het
Ttn A C 2: 76,753,906 L20540* probably null Het
Usf3 A T 16: 44,217,888 K910N possibly damaging Het
Vmn1r14 T G 6: 57,234,228 Y220D possibly damaging Het
Vmn1r209 T A 13: 22,806,498 K7N probably benign Het
Other mutations in Cela3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Cela3b APN 4 137423281 missense probably damaging 1.00
IGL00708:Cela3b APN 4 137421969 missense probably benign
IGL01301:Cela3b APN 4 137423843 critical splice donor site probably null
IGL01613:Cela3b APN 4 137425071 missense possibly damaging 0.66
ANU18:Cela3b UTSW 4 137423843 critical splice donor site probably null
R0669:Cela3b UTSW 4 137428530 missense probably benign 0.06
R2937:Cela3b UTSW 4 137423263 missense probably benign 0.01
R2938:Cela3b UTSW 4 137423263 missense probably benign 0.01
R4327:Cela3b UTSW 4 137423931 missense probably benign 0.26
R5059:Cela3b UTSW 4 137424870 missense probably benign 0.00
R5707:Cela3b UTSW 4 137424856 missense probably damaging 1.00
R7952:Cela3b UTSW 4 137421908 missense probably benign 0.27
X0019:Cela3b UTSW 4 137423310 missense probably damaging 1.00
X0019:Cela3b UTSW 4 137423311 missense probably damaging 1.00
Z1177:Cela3b UTSW 4 137428484 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGGACGTCCTATGCCCTTG -3'
(R):5'- TGAGAATACCCATGAAGCCAGG -3'

Sequencing Primer
(F):5'- ATGCTGGTCACCCCACTG -3'
(R):5'- TAGGCCCAAAGCTTGCA -3'
Posted On2015-07-21