Incidental Mutation 'R4451:Baiap2l1'
ID 328964
Institutional Source Beutler Lab
Gene Symbol Baiap2l1
Ensembl Gene ENSMUSG00000038859
Gene Name BAI1-associated protein 2-like 1
Synonyms 1300006M19Rik, IRTKS
MMRRC Submission 041712-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4451 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 144201336-144294922 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 144215362 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 381 (Y381F)
Ref Sequence ENSEMBL: ENSMUSP00000053129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055190] [ENSMUST00000155491]
AlphaFold Q9DBJ3
PDB Structure Solution Structure of RSGI RUH-010, an SH3 Domain from Mouse cDNA [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000055190
AA Change: Y381F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053129
Gene: ENSMUSG00000038859
AA Change: Y381F

DomainStartEndE-ValueType
Pfam:IMD 16 236 4.4e-65 PFAM
SH3 343 402 1.42e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129287
Predicted Effect probably benign
Transcript: ENSMUST00000155491
SMART Domains Protein: ENSMUSP00000122016
Gene: ENSMUSG00000047843

DomainStartEndE-ValueType
Pfam:DUF2367 27 90 1.1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198873
Meta Mutation Damage Score 0.6007 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IMD (IRSp53/MIM homology domain) family. Members of this family can be subdivided in two groups, the IRSp53-like and MIM-like, based on the presence or absence of the SH3 (Src homology 3) domain. The protein encoded by this gene contains a conserved IMD, also known as F-actin bundling domain, at the N-terminus, and a canonical SH3 domain near the C-terminus, so it belongs to the IRSp53-like group. This protein is the substrate for insulin receptor tyrosine kinase and binds to the small GTPase Rac. It is involved in signal transduction pathways that link deformation of the plasma membrane and remodeling of the actin cytoskeleton. It also promotes actin assembly and membrane protrusions when overexpressed in mammalian cells, and is essential to the formation of a potent actin assembly complex during EHEC (Enterohemorrhagic Escherichia coli) pedestal formation. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased circulating glucose and insulin levels, impaired glucose tolerance and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 A C 5: 62,906,513 (GRCm39) F169V probably benign Het
Cdc27 A T 11: 104,408,221 (GRCm39) M563K probably benign Het
Cela3b G A 4: 137,148,355 (GRCm39) probably benign Het
Cyp2c29 A T 19: 39,279,270 (GRCm39) D50V probably damaging Het
Dbpht2 A T 12: 74,345,806 (GRCm39) noncoding transcript Het
Dnah9 T A 11: 65,772,467 (GRCm39) Q3755L probably benign Het
Dnajc2 T C 5: 21,962,792 (GRCm39) T588A possibly damaging Het
Dync2h1 T A 9: 6,983,477 (GRCm39) R4022S probably benign Het
Gm20481 T G 17: 35,191,109 (GRCm39) probably benign Het
Gm7347 A G 5: 26,260,004 (GRCm39) I182T possibly damaging Het
Gns G A 10: 121,212,601 (GRCm39) G188S probably damaging Het
Grm5 T G 7: 87,724,340 (GRCm39) probably null Het
Gstm4 T C 3: 107,951,291 (GRCm39) probably null Het
Il7r T A 15: 9,513,034 (GRCm39) K158N probably benign Het
Irs1 T C 1: 82,266,749 (GRCm39) Y489C probably benign Het
Kcns1 C T 2: 164,010,598 (GRCm39) E54K possibly damaging Het
Klra5 T A 6: 129,885,797 (GRCm39) R31* probably null Het
Krt13 T C 11: 100,008,827 (GRCm39) T409A unknown Het
Lce1e C T 3: 92,614,967 (GRCm39) G127S unknown Het
Mfsd14a T C 3: 116,456,127 (GRCm39) M1V probably null Het
Micall2 T C 5: 139,692,852 (GRCm39) E891G probably damaging Het
Mpeg1 A T 19: 12,440,596 (GRCm39) K685* probably null Het
Nbea A G 3: 55,899,753 (GRCm39) probably null Het
Nup155 A G 15: 8,180,366 (GRCm39) M1148V probably benign Het
Or51aa5 A G 7: 103,167,184 (GRCm39) S136P probably damaging Het
Or5m3b T C 2: 85,872,303 (GRCm39) S215P probably damaging Het
Otof T A 5: 30,542,508 (GRCm39) D695V possibly damaging Het
Ptf1a G T 2: 19,451,092 (GRCm39) A141S possibly damaging Het
Pxmp2 A T 5: 110,425,531 (GRCm39) V168E probably damaging Het
Rab11fip1 T C 8: 27,644,505 (GRCm39) K427E probably damaging Het
Susd2 A G 10: 75,475,232 (GRCm39) V526A probably damaging Het
Tbx2 T C 11: 85,731,643 (GRCm39) S647P probably damaging Het
Tg A G 15: 66,637,996 (GRCm39) T651A probably benign Het
Trim68 T A 7: 102,333,680 (GRCm39) M1L probably damaging Het
Ttn A C 2: 76,584,250 (GRCm39) L20540* probably null Het
Usf3 A T 16: 44,038,251 (GRCm39) K910N possibly damaging Het
Vmn1r14 T G 6: 57,211,213 (GRCm39) Y220D possibly damaging Het
Vmn1r209 T A 13: 22,990,668 (GRCm39) K7N probably benign Het
Other mutations in Baiap2l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00789:Baiap2l1 APN 5 144,222,879 (GRCm39) splice site probably null
IGL00789:Baiap2l1 APN 5 144,222,356 (GRCm39) nonsense probably null
IGL00922:Baiap2l1 APN 5 144,255,777 (GRCm39) missense probably damaging 1.00
IGL01446:Baiap2l1 APN 5 144,212,723 (GRCm39) missense probably benign 0.10
IGL01603:Baiap2l1 APN 5 144,217,625 (GRCm39) intron probably benign
IGL02748:Baiap2l1 APN 5 144,203,415 (GRCm39) intron probably benign
IGL03348:Baiap2l1 APN 5 144,215,341 (GRCm39) missense probably benign 0.08
PIT4382001:Baiap2l1 UTSW 5 144,215,480 (GRCm39) missense possibly damaging 0.71
R0066:Baiap2l1 UTSW 5 144,221,372 (GRCm39) missense probably damaging 1.00
R0066:Baiap2l1 UTSW 5 144,221,372 (GRCm39) missense probably damaging 1.00
R0110:Baiap2l1 UTSW 5 144,212,701 (GRCm39) missense probably damaging 1.00
R0197:Baiap2l1 UTSW 5 144,202,820 (GRCm39) missense probably damaging 0.96
R0469:Baiap2l1 UTSW 5 144,212,701 (GRCm39) missense probably damaging 1.00
R0744:Baiap2l1 UTSW 5 144,203,451 (GRCm39) missense probably benign 0.21
R0755:Baiap2l1 UTSW 5 144,221,367 (GRCm39) missense probably damaging 0.97
R0765:Baiap2l1 UTSW 5 144,214,513 (GRCm39) missense probably damaging 0.99
R1051:Baiap2l1 UTSW 5 144,222,943 (GRCm39) missense probably damaging 1.00
R1809:Baiap2l1 UTSW 5 144,261,365 (GRCm39) critical splice donor site probably null
R3889:Baiap2l1 UTSW 5 144,215,345 (GRCm39) missense possibly damaging 0.67
R5093:Baiap2l1 UTSW 5 144,215,363 (GRCm39) missense probably damaging 1.00
R5471:Baiap2l1 UTSW 5 144,218,951 (GRCm39) missense probably benign 0.01
R5523:Baiap2l1 UTSW 5 144,212,768 (GRCm39) missense probably damaging 1.00
R5524:Baiap2l1 UTSW 5 144,217,759 (GRCm39) missense probably benign 0.01
R5586:Baiap2l1 UTSW 5 144,218,949 (GRCm39) missense probably damaging 0.99
R5603:Baiap2l1 UTSW 5 144,202,787 (GRCm39) missense probably damaging 1.00
R5735:Baiap2l1 UTSW 5 144,223,112 (GRCm39) missense probably damaging 1.00
R6353:Baiap2l1 UTSW 5 144,218,898 (GRCm39) missense possibly damaging 0.80
R6572:Baiap2l1 UTSW 5 144,223,112 (GRCm39) missense probably damaging 1.00
R6619:Baiap2l1 UTSW 5 144,222,916 (GRCm39) missense probably benign 0.22
R6981:Baiap2l1 UTSW 5 144,222,389 (GRCm39) missense possibly damaging 0.94
R7218:Baiap2l1 UTSW 5 144,212,687 (GRCm39) missense probably benign 0.01
R7352:Baiap2l1 UTSW 5 144,261,436 (GRCm39) missense probably benign 0.03
R7662:Baiap2l1 UTSW 5 144,294,700 (GRCm39) intron probably benign
R7797:Baiap2l1 UTSW 5 144,255,760 (GRCm39) missense probably damaging 1.00
R7981:Baiap2l1 UTSW 5 144,294,700 (GRCm39) intron probably benign
R8170:Baiap2l1 UTSW 5 144,214,502 (GRCm39) nonsense probably null
R8308:Baiap2l1 UTSW 5 144,214,487 (GRCm39) missense probably benign 0.06
R8333:Baiap2l1 UTSW 5 144,217,691 (GRCm39) missense possibly damaging 0.89
R8673:Baiap2l1 UTSW 5 144,212,852 (GRCm39) intron probably benign
R8976:Baiap2l1 UTSW 5 144,223,117 (GRCm39) missense probably benign 0.03
R9187:Baiap2l1 UTSW 5 144,217,764 (GRCm39) missense probably benign 0.01
X0022:Baiap2l1 UTSW 5 144,215,462 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGGAATGCAAAACCAGC -3'
(R):5'- CGTTCTCTGAGTCACCATTATGG -3'

Sequencing Primer
(F):5'- CAGCAGTGGCCCAGACTATATAAAG -3'
(R):5'- GAGTCACCATTATGGCCTTGC -3'
Posted On 2015-07-21