Incidental Mutation 'R4451:Susd2'
ID328973
Institutional Source Beutler Lab
Gene Symbol Susd2
Ensembl Gene ENSMUSG00000006342
Gene Namesushi domain containing 2
Synonyms1200011D11Rik
MMRRC Submission 041712-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R4451 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location75636706-75644008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75639398 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 526 (V526A)
Ref Sequence ENSEMBL: ENSMUSP00000093197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077610] [ENSMUST00000095541]
Predicted Effect probably damaging
Transcript: ENSMUST00000077610
AA Change: V406A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000076802
Gene: ENSMUSG00000006342
AA Change: V406A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
AMOP 162 310 4.09e-82 SMART
VWD 313 489 1.9e-19 SMART
CCP 602 655 3.37e-17 SMART
transmembrane domain 663 685 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095541
AA Change: V526A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000093197
Gene: ENSMUSG00000006342
AA Change: V526A

DomainStartEndE-ValueType
SO 25 64 4.77e-2 SMART
AMOP 282 430 4.09e-82 SMART
VWD 433 609 1.9e-19 SMART
CCP 722 775 3.37e-17 SMART
transmembrane domain 783 805 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219733
Meta Mutation Damage Score 0.5698 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 A C 5: 62,749,170 F169V probably benign Het
Baiap2l1 T A 5: 144,278,552 Y381F probably damaging Het
Cdc27 A T 11: 104,517,395 M563K probably benign Het
Cela3b G A 4: 137,421,044 probably benign Het
Cyp2c29 A T 19: 39,290,826 D50V probably damaging Het
Dbpht2 A T 12: 74,299,032 noncoding transcript Het
Dnah9 T A 11: 65,881,641 Q3755L probably benign Het
Dnajc2 T C 5: 21,757,794 T588A possibly damaging Het
Dync2h1 T A 9: 6,983,477 R4022S probably benign Het
Gm20481 T G 17: 34,972,133 probably benign Het
Gm7347 A G 5: 26,055,006 I182T possibly damaging Het
Gns G A 10: 121,376,696 G188S probably damaging Het
Grm5 T G 7: 88,075,132 probably null Het
Gstm4 T C 3: 108,043,975 probably null Het
Il7r T A 15: 9,512,948 K158N probably benign Het
Irs1 T C 1: 82,289,028 Y489C probably benign Het
Kcns1 C T 2: 164,168,678 E54K possibly damaging Het
Klra5 T A 6: 129,908,834 R31* probably null Het
Krt13 T C 11: 100,118,001 T409A unknown Het
Lce1e C T 3: 92,707,660 G127S unknown Het
Mfsd14a T C 3: 116,662,478 M1V probably null Het
Micall2 T C 5: 139,707,097 E891G probably damaging Het
Mpeg1 A T 19: 12,463,232 K685* probably null Het
Nbea A G 3: 55,992,332 probably null Het
Nup155 A G 15: 8,150,882 M1148V probably benign Het
Olfr1033 T C 2: 86,041,959 S215P probably damaging Het
Olfr611 A G 7: 103,517,977 S136P probably damaging Het
Otof T A 5: 30,385,164 D695V possibly damaging Het
Ptf1a G T 2: 19,446,281 A141S possibly damaging Het
Pxmp2 A T 5: 110,277,665 V168E probably damaging Het
Rab11fip1 T C 8: 27,154,477 K427E probably damaging Het
Tbx2 T C 11: 85,840,817 S647P probably damaging Het
Tg A G 15: 66,766,147 T651A probably benign Het
Trim68 T A 7: 102,684,473 M1L probably damaging Het
Ttn A C 2: 76,753,906 L20540* probably null Het
Usf3 A T 16: 44,217,888 K910N possibly damaging Het
Vmn1r14 T G 6: 57,234,228 Y220D possibly damaging Het
Vmn1r209 T A 13: 22,806,498 K7N probably benign Het
Other mutations in Susd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Susd2 APN 10 75638048 missense probably benign 0.02
IGL00907:Susd2 APN 10 75640931 missense probably benign 0.04
IGL01155:Susd2 APN 10 75640892 missense possibly damaging 0.87
IGL01677:Susd2 APN 10 75639431 missense possibly damaging 0.91
IGL02146:Susd2 APN 10 75638433 missense possibly damaging 0.79
IGL02273:Susd2 APN 10 75640938 missense possibly damaging 0.94
IGL02386:Susd2 APN 10 75640095 missense probably damaging 0.97
IGL02475:Susd2 APN 10 75637499 critical splice donor site probably null
IGL03218:Susd2 APN 10 75642625 missense probably benign
PIT4418001:Susd2 UTSW 10 75638349 missense probably benign 0.24
R0135:Susd2 UTSW 10 75638514 missense probably damaging 1.00
R0396:Susd2 UTSW 10 75639911 missense probably damaging 1.00
R0401:Susd2 UTSW 10 75638603 splice site probably benign
R0608:Susd2 UTSW 10 75638235 missense probably benign 0.45
R0636:Susd2 UTSW 10 75639350 missense probably damaging 1.00
R1470:Susd2 UTSW 10 75638054 missense probably damaging 1.00
R1470:Susd2 UTSW 10 75638054 missense probably damaging 1.00
R1619:Susd2 UTSW 10 75638044 missense possibly damaging 0.66
R1634:Susd2 UTSW 10 75637555 missense probably benign 0.04
R1866:Susd2 UTSW 10 75639732 missense probably damaging 0.98
R4354:Susd2 UTSW 10 75639728 missense probably damaging 0.99
R4721:Susd2 UTSW 10 75638130 missense probably benign 0.00
R5546:Susd2 UTSW 10 75642218 missense probably benign 0.01
R5768:Susd2 UTSW 10 75638019 missense probably damaging 0.98
R5769:Susd2 UTSW 10 75638019 missense probably damaging 0.98
R5770:Susd2 UTSW 10 75638019 missense probably damaging 0.98
R5771:Susd2 UTSW 10 75638019 missense probably damaging 0.98
R5960:Susd2 UTSW 10 75639936 missense probably damaging 1.00
R6152:Susd2 UTSW 10 75638019 missense probably damaging 0.98
R6153:Susd2 UTSW 10 75638019 missense probably damaging 0.98
R6259:Susd2 UTSW 10 75638046 missense probably damaging 1.00
R6291:Susd2 UTSW 10 75637574 missense possibly damaging 0.61
R7106:Susd2 UTSW 10 75638053 missense probably damaging 1.00
R7232:Susd2 UTSW 10 75639851 missense probably damaging 1.00
R7297:Susd2 UTSW 10 75642568 missense probably benign 0.19
R7326:Susd2 UTSW 10 75642565 missense probably benign 0.00
R7905:Susd2 UTSW 10 75639657 nonsense probably null
R7988:Susd2 UTSW 10 75639657 nonsense probably null
X0025:Susd2 UTSW 10 75640572 nonsense probably null
Z1177:Susd2 UTSW 10 75640478 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGGGTCTTGACTTCTGCAAGAC -3'
(R):5'- AGAATGCCCAATGGTGAGGC -3'

Sequencing Primer
(F):5'- GTCTTGACTTCTGCAAGACCCAAG -3'
(R):5'- CCTGTGGCCTCTACGTTGG -3'
Posted On2015-07-21