Incidental Mutation 'R4452:D5Ertd579e'
ID328999
Institutional Source Beutler Lab
Gene Symbol D5Ertd579e
Ensembl Gene ENSMUSG00000029190
Gene NameDNA segment, Chr 5, ERATO Doi 579, expressed
Synonyms
MMRRC Submission 041713-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.250) question?
Stock #R4452 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location36600485-36696024 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36616470 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 194 (W194R)
Ref Sequence ENSEMBL: ENSMUSP00000031091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031091]
Predicted Effect probably damaging
Transcript: ENSMUST00000031091
AA Change: W194R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031091
Gene: ENSMUSG00000029190
AA Change: W194R

DomainStartEndE-ValueType
Pfam:DUF4603 23 1303 N/A PFAM
low complexity region 1365 1376 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132383
SMART Domains Protein: ENSMUSP00000116548
Gene: ENSMUSG00000029190

DomainStartEndE-ValueType
Pfam:DUF4603 1 1181 N/A PFAM
low complexity region 1243 1254 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140063
SMART Domains Protein: ENSMUSP00000118804
Gene: ENSMUSG00000029190

DomainStartEndE-ValueType
Pfam:DUF4603 23 77 1e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150088
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201187
Meta Mutation Damage Score 0.5806 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 A G 7: 119,698,574 T145A possibly damaging Het
Adgra1 G T 7: 139,852,521 A92S probably benign Het
Aim2 A G 1: 173,455,444 T31A possibly damaging Het
Cd46 G A 1: 195,085,360 A131V possibly damaging Het
Cdc27 A T 11: 104,517,395 M563K probably benign Het
Chd9 A T 8: 90,977,680 N721I probably damaging Het
Cnn2 A G 10: 79,991,442 D49G probably benign Het
Cul1 T A 6: 47,508,989 Y323* probably null Het
Dhx15 G A 5: 52,166,732 P406L probably benign Het
Dnah9 C T 11: 66,027,082 A2249T probably damaging Het
Dppa4 T A 16: 48,289,336 D106E probably benign Het
Gja10 A G 4: 32,601,313 V357A probably benign Het
Gm20481 T G 17: 34,972,133 probably benign Het
Grxcr2 T C 18: 41,986,544 N244D probably damaging Het
Klk1b11 T A 7: 43,995,911 F3I probably damaging Het
Mid1 T C X: 169,927,425 V139A possibly damaging Het
Mycbp2 T C 14: 103,155,658 K3046E probably damaging Het
Nfasc T C 1: 132,634,671 N122S probably damaging Het
Olfr1099 C T 2: 86,958,699 G253D probably damaging Het
Olfr1232 T A 2: 89,325,253 D309V possibly damaging Het
Olfr556 T C 7: 102,670,049 V43A probably benign Het
Olfr655 T A 7: 104,596,639 M181L probably damaging Het
Olfr736 A T 14: 50,392,912 Y52F probably benign Het
Olfr933 T C 9: 38,976,086 S137P probably benign Het
P2ry10b C T X: 107,171,118 T28I probably damaging Het
Pdxdc1 T C 16: 13,837,126 Y675C possibly damaging Het
Plcl1 A G 1: 55,696,886 N462S probably benign Het
Ptf1a G T 2: 19,446,281 A141S possibly damaging Het
Pzp A G 6: 128,491,240 L1028P probably damaging Het
Qrsl1 A G 10: 43,882,162 S312P probably damaging Het
Sars2 A G 7: 28,750,093 T349A probably benign Het
Scarb1 A T 5: 125,300,345 F208I probably damaging Het
Scn8a A G 15: 100,957,091 N153S possibly damaging Het
Sema4c A T 1: 36,553,756 V127D probably benign Het
Smg6 C G 11: 74,990,141 S931C probably benign Het
Trpm2 A T 10: 77,923,593 L1119Q probably damaging Het
Ubtd2 T A 11: 32,499,406 N84K probably damaging Het
Ugt2b35 A T 5: 87,003,378 H281L probably damaging Het
Umodl1 T C 17: 30,994,815 probably null Het
Other mutations in D5Ertd579e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:D5Ertd579e APN 5 36618754 missense probably damaging 0.99
IGL01925:D5Ertd579e APN 5 36614284 missense possibly damaging 0.67
IGL01933:D5Ertd579e APN 5 36615756 missense probably benign
IGL02164:D5Ertd579e APN 5 36614959 missense probably damaging 1.00
IGL02399:D5Ertd579e APN 5 36616185 missense probably damaging 1.00
IGL02896:D5Ertd579e APN 5 36613982 missense possibly damaging 0.70
IGL03141:D5Ertd579e APN 5 36613277 missense possibly damaging 0.94
IGL03235:D5Ertd579e APN 5 36618828 splice site probably benign
R0201:D5Ertd579e UTSW 5 36616465 missense probably damaging 1.00
R0377:D5Ertd579e UTSW 5 36604567 missense probably benign 0.12
R0830:D5Ertd579e UTSW 5 36613757 missense probably damaging 1.00
R0926:D5Ertd579e UTSW 5 36672866 missense probably damaging 1.00
R1350:D5Ertd579e UTSW 5 36613737 missense probably damaging 1.00
R1448:D5Ertd579e UTSW 5 36602739 missense probably benign
R1672:D5Ertd579e UTSW 5 36613277 missense possibly damaging 0.50
R1676:D5Ertd579e UTSW 5 36616109 missense probably benign 0.01
R1693:D5Ertd579e UTSW 5 36614097 missense probably damaging 0.98
R1698:D5Ertd579e UTSW 5 36604530 missense probably benign
R1868:D5Ertd579e UTSW 5 36616427 missense probably damaging 0.99
R1909:D5Ertd579e UTSW 5 36614058 missense probably benign 0.21
R2034:D5Ertd579e UTSW 5 36613538 nonsense probably null
R2080:D5Ertd579e UTSW 5 36616206 missense probably benign 0.01
R2105:D5Ertd579e UTSW 5 36613449 missense probably benign 0.12
R2197:D5Ertd579e UTSW 5 36614793 missense possibly damaging 0.69
R4212:D5Ertd579e UTSW 5 36614479 missense probably damaging 0.99
R4626:D5Ertd579e UTSW 5 36614559 missense possibly damaging 0.92
R4804:D5Ertd579e UTSW 5 36629652 splice site probably null
R4898:D5Ertd579e UTSW 5 36614941 missense probably damaging 0.99
R4917:D5Ertd579e UTSW 5 36615816 missense probably damaging 1.00
R4960:D5Ertd579e UTSW 5 36616227 nonsense probably null
R4973:D5Ertd579e UTSW 5 36672905 missense probably benign
R5092:D5Ertd579e UTSW 5 36602703 missense probably benign 0.18
R5474:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5475:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5476:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5477:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5801:D5Ertd579e UTSW 5 36604569 missense probably damaging 1.00
R6019:D5Ertd579e UTSW 5 36629692 missense possibly damaging 0.90
R6184:D5Ertd579e UTSW 5 36629783 missense probably damaging 0.99
R6213:D5Ertd579e UTSW 5 36602634 missense probably damaging 1.00
R6244:D5Ertd579e UTSW 5 36615276 missense probably damaging 0.98
R6276:D5Ertd579e UTSW 5 36604514 missense possibly damaging 0.66
R6285:D5Ertd579e UTSW 5 36615577 missense probably damaging 1.00
R6358:D5Ertd579e UTSW 5 36616236 splice site probably null
R6875:D5Ertd579e UTSW 5 36604657 splice site probably null
R6967:D5Ertd579e UTSW 5 36615756 missense probably benign
R7139:D5Ertd579e UTSW 5 36613976 missense probably damaging 1.00
R7329:D5Ertd579e UTSW 5 36616395 missense probably benign 0.21
R7464:D5Ertd579e UTSW 5 36613785 missense probably damaging 0.99
R7664:D5Ertd579e UTSW 5 36614617 missense probably benign 0.00
R7762:D5Ertd579e UTSW 5 36613381 missense
R7951:D5Ertd579e UTSW 5 36615173 missense probably benign
R8175:D5Ertd579e UTSW 5 36615470 missense probably damaging 1.00
R8217:D5Ertd579e UTSW 5 36614058 missense probably benign 0.00
R8233:D5Ertd579e UTSW 5 36615244 missense probably damaging 0.99
R8281:D5Ertd579e UTSW 5 36613320 missense
R8398:D5Ertd579e UTSW 5 36614277 nonsense probably null
RF022:D5Ertd579e UTSW 5 36614662 missense probably damaging 1.00
X0019:D5Ertd579e UTSW 5 36613958 missense probably damaging 1.00
Z1176:D5Ertd579e UTSW 5 36615762 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTAAAAGGCAGGCTTTTCTTCG -3'
(R):5'- TGACATTAGTGAGCTAAGGCAC -3'

Sequencing Primer
(F):5'- ATGGTGCTACTGCTCAGC -3'
(R):5'- GTGTGCCTTGCTTATGAAC -3'
Posted On2015-07-21