Incidental Mutation 'R4452:Ugt2b35'
ID329001
Institutional Source Beutler Lab
Gene Symbol Ugt2b35
Ensembl Gene ENSMUSG00000035811
Gene NameUDP glucuronosyltransferase 2 family, polypeptide B35
Synonyms
MMRRC Submission 041713-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4452 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location87000860-87013275 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87003378 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 281 (H281L)
Ref Sequence ENSEMBL: ENSMUSP00000031186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031186]
Predicted Effect probably damaging
Transcript: ENSMUST00000031186
AA Change: H281L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031186
Gene: ENSMUSG00000035811
AA Change: H281L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 526 1e-253 PFAM
Pfam:Glyco_tran_28_C 338 449 1.9e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200248
Meta Mutation Damage Score 0.0216 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 A G 7: 119,698,574 T145A possibly damaging Het
Adgra1 G T 7: 139,852,521 A92S probably benign Het
Aim2 A G 1: 173,455,444 T31A possibly damaging Het
Cd46 G A 1: 195,085,360 A131V possibly damaging Het
Cdc27 A T 11: 104,517,395 M563K probably benign Het
Chd9 A T 8: 90,977,680 N721I probably damaging Het
Cnn2 A G 10: 79,991,442 D49G probably benign Het
Cul1 T A 6: 47,508,989 Y323* probably null Het
D5Ertd579e A G 5: 36,616,470 W194R probably damaging Het
Dhx15 G A 5: 52,166,732 P406L probably benign Het
Dnah9 C T 11: 66,027,082 A2249T probably damaging Het
Dppa4 T A 16: 48,289,336 D106E probably benign Het
Gja10 A G 4: 32,601,313 V357A probably benign Het
Gm20481 T G 17: 34,972,133 probably benign Het
Grxcr2 T C 18: 41,986,544 N244D probably damaging Het
Klk1b11 T A 7: 43,995,911 F3I probably damaging Het
Mid1 T C X: 169,927,425 V139A possibly damaging Het
Mycbp2 T C 14: 103,155,658 K3046E probably damaging Het
Nfasc T C 1: 132,634,671 N122S probably damaging Het
Olfr1099 C T 2: 86,958,699 G253D probably damaging Het
Olfr1232 T A 2: 89,325,253 D309V possibly damaging Het
Olfr556 T C 7: 102,670,049 V43A probably benign Het
Olfr655 T A 7: 104,596,639 M181L probably damaging Het
Olfr736 A T 14: 50,392,912 Y52F probably benign Het
Olfr933 T C 9: 38,976,086 S137P probably benign Het
P2ry10b C T X: 107,171,118 T28I probably damaging Het
Pdxdc1 T C 16: 13,837,126 Y675C possibly damaging Het
Plcl1 A G 1: 55,696,886 N462S probably benign Het
Ptf1a G T 2: 19,446,281 A141S possibly damaging Het
Pzp A G 6: 128,491,240 L1028P probably damaging Het
Qrsl1 A G 10: 43,882,162 S312P probably damaging Het
Sars2 A G 7: 28,750,093 T349A probably benign Het
Scarb1 A T 5: 125,300,345 F208I probably damaging Het
Scn8a A G 15: 100,957,091 N153S possibly damaging Het
Sema4c A T 1: 36,553,756 V127D probably benign Het
Smg6 C G 11: 74,990,141 S931C probably benign Het
Trpm2 A T 10: 77,923,593 L1119Q probably damaging Het
Ubtd2 T A 11: 32,499,406 N84K probably damaging Het
Umodl1 T C 17: 30,994,815 probably null Het
Other mutations in Ugt2b35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Ugt2b35 APN 5 87008192 missense probably benign 0.00
IGL01109:Ugt2b35 APN 5 87008306 missense probably damaging 1.00
IGL01586:Ugt2b35 APN 5 87011391 missense probably benign 0.07
IGL02151:Ugt2b35 APN 5 87003282 missense possibly damaging 0.65
IGL02225:Ugt2b35 APN 5 87007405 splice site probably benign
IGL02483:Ugt2b35 APN 5 87001145 missense possibly damaging 0.87
IGL02504:Ugt2b35 APN 5 87001541 missense possibly damaging 0.50
IGL02690:Ugt2b35 APN 5 87001237 missense probably benign 0.01
IGL02954:Ugt2b35 APN 5 87011321 missense probably benign 0.00
IGL03242:Ugt2b35 APN 5 87007395 missense probably damaging 1.00
R0329:Ugt2b35 UTSW 5 87003405 missense probably null 0.38
R0513:Ugt2b35 UTSW 5 87003412 splice site probably benign
R0571:Ugt2b35 UTSW 5 87000934 missense possibly damaging 0.51
R0827:Ugt2b35 UTSW 5 87008130 splice site probably benign
R1396:Ugt2b35 UTSW 5 87011530 missense possibly damaging 0.56
R1437:Ugt2b35 UTSW 5 87001031 missense probably benign 0.02
R1557:Ugt2b35 UTSW 5 87007297 splice site probably null
R1869:Ugt2b35 UTSW 5 87001288 missense probably damaging 1.00
R1937:Ugt2b35 UTSW 5 87001282 missense probably damaging 1.00
R2067:Ugt2b35 UTSW 5 87001553 missense probably damaging 1.00
R2219:Ugt2b35 UTSW 5 87003332 missense possibly damaging 0.81
R3055:Ugt2b35 UTSW 5 87001598 missense probably benign 0.05
R3793:Ugt2b35 UTSW 5 87001606 missense probably benign 0.15
R4548:Ugt2b35 UTSW 5 87008275 nonsense probably null
R4902:Ugt2b35 UTSW 5 87003300 missense possibly damaging 0.89
R5311:Ugt2b35 UTSW 5 87011280 nonsense probably null
R6187:Ugt2b35 UTSW 5 87007322 missense probably damaging 0.98
R6332:Ugt2b35 UTSW 5 87001556 missense probably damaging 1.00
R6719:Ugt2b35 UTSW 5 87007388 missense probably damaging 1.00
R7211:Ugt2b35 UTSW 5 87001318 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- CAGATGACAGTCCTGTTAACTTTTCC -3'
(R):5'- AGGTGGATTGTGAGATTCAAACTC -3'

Sequencing Primer
(F):5'- GACAGTCCTGTTAACTTTTCCCTGTC -3'
(R):5'- GAATATATACCAAGTCTCGCATGC -3'
Posted On2015-07-21