Incidental Mutation 'R4452:Pzp'
ID329004
Institutional Source Beutler Lab
Gene Symbol Pzp
Ensembl Gene ENSMUSG00000030359
Gene NamePZP, alpha-2-macroglobulin like
Synonyms
MMRRC Submission 041713-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R4452 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location128483567-128526720 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128491240 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1028 (L1028P)
Ref Sequence ENSEMBL: ENSMUSP00000107760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112132]
Predicted Effect probably damaging
Transcript: ENSMUST00000112132
AA Change: L1028P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107760
Gene: ENSMUSG00000030359
AA Change: L1028P

DomainStartEndE-ValueType
low complexity region 11 18 N/A INTRINSIC
Pfam:A2M_N 126 219 3.2e-23 PFAM
low complexity region 327 338 N/A INTRINSIC
A2M_N_2 458 606 6.18e-40 SMART
A2M 750 840 2.27e-38 SMART
Pfam:Thiol-ester_cl 973 1003 4e-19 PFAM
Pfam:A2M_comp 1022 1284 2.1e-90 PFAM
A2M_recep 1395 1482 6.47e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203753
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204291
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 98% (48/49)
MGI Phenotype PHENOTYPE: Homozygotes mutant null mice show higher bone mineral density, hypoactivity, and decreased heart rate. Mice homozygous for a different null allele show resistance to the lethal effects of endotoxin, increased susceptibility to diet-induced acute pancreatitis, and altered LPS-induced febrile and cytokine responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 A G 7: 119,698,574 T145A possibly damaging Het
Adgra1 G T 7: 139,852,521 A92S probably benign Het
Aim2 A G 1: 173,455,444 T31A possibly damaging Het
Cd46 G A 1: 195,085,360 A131V possibly damaging Het
Cdc27 A T 11: 104,517,395 M563K probably benign Het
Chd9 A T 8: 90,977,680 N721I probably damaging Het
Cnn2 A G 10: 79,991,442 D49G probably benign Het
Cul1 T A 6: 47,508,989 Y323* probably null Het
D5Ertd579e A G 5: 36,616,470 W194R probably damaging Het
Dhx15 G A 5: 52,166,732 P406L probably benign Het
Dnah9 C T 11: 66,027,082 A2249T probably damaging Het
Dppa4 T A 16: 48,289,336 D106E probably benign Het
Gja10 A G 4: 32,601,313 V357A probably benign Het
Gm20481 T G 17: 34,972,133 probably benign Het
Grxcr2 T C 18: 41,986,544 N244D probably damaging Het
Klk1b11 T A 7: 43,995,911 F3I probably damaging Het
Mid1 T C X: 169,927,425 V139A possibly damaging Het
Mycbp2 T C 14: 103,155,658 K3046E probably damaging Het
Nfasc T C 1: 132,634,671 N122S probably damaging Het
Olfr1099 C T 2: 86,958,699 G253D probably damaging Het
Olfr1232 T A 2: 89,325,253 D309V possibly damaging Het
Olfr556 T C 7: 102,670,049 V43A probably benign Het
Olfr655 T A 7: 104,596,639 M181L probably damaging Het
Olfr736 A T 14: 50,392,912 Y52F probably benign Het
Olfr933 T C 9: 38,976,086 S137P probably benign Het
P2ry10b C T X: 107,171,118 T28I probably damaging Het
Pdxdc1 T C 16: 13,837,126 Y675C possibly damaging Het
Plcl1 A G 1: 55,696,886 N462S probably benign Het
Ptf1a G T 2: 19,446,281 A141S possibly damaging Het
Qrsl1 A G 10: 43,882,162 S312P probably damaging Het
Sars2 A G 7: 28,750,093 T349A probably benign Het
Scarb1 A T 5: 125,300,345 F208I probably damaging Het
Scn8a A G 15: 100,957,091 N153S possibly damaging Het
Sema4c A T 1: 36,553,756 V127D probably benign Het
Smg6 C G 11: 74,990,141 S931C probably benign Het
Trpm2 A T 10: 77,923,593 L1119Q probably damaging Het
Ubtd2 T A 11: 32,499,406 N84K probably damaging Het
Ugt2b35 A T 5: 87,003,378 H281L probably damaging Het
Umodl1 T C 17: 30,994,815 probably null Het
Other mutations in Pzp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Pzp APN 6 128516909 missense probably benign 0.25
IGL01470:Pzp APN 6 128521124 missense probably benign 0.05
IGL01753:Pzp APN 6 128502183 missense possibly damaging 0.78
IGL01878:Pzp APN 6 128495298 missense probably damaging 1.00
IGL02307:Pzp APN 6 128489086 nonsense probably null
IGL02338:Pzp APN 6 128486170 missense probably benign 0.07
IGL02546:Pzp APN 6 128494699 splice site probably benign
IGL02598:Pzp APN 6 128487457 missense probably benign 0.00
IGL02699:Pzp APN 6 128487401 critical splice donor site probably null
lilibet UTSW 6 128513773 missense probably damaging 0.99
P4748:Pzp UTSW 6 128490089 missense probably damaging 1.00
PIT4151001:Pzp UTSW 6 128525296 missense probably benign 0.34
PIT4495001:Pzp UTSW 6 128502229 missense probably benign
R0157:Pzp UTSW 6 128523976 nonsense probably null
R0195:Pzp UTSW 6 128487478 missense probably damaging 1.00
R0238:Pzp UTSW 6 128489156 splice site probably benign
R0239:Pzp UTSW 6 128489156 splice site probably benign
R0271:Pzp UTSW 6 128519514 missense probably damaging 1.00
R0299:Pzp UTSW 6 128495330 splice site probably benign
R0744:Pzp UTSW 6 128516195 unclassified probably benign
R0968:Pzp UTSW 6 128525145 missense probably benign 0.00
R1037:Pzp UTSW 6 128519426 missense probably benign 0.01
R1074:Pzp UTSW 6 128487924 missense probably benign 0.20
R1469:Pzp UTSW 6 128512356 missense probably benign 0.04
R1469:Pzp UTSW 6 128512356 missense probably benign 0.04
R1579:Pzp UTSW 6 128523968 critical splice donor site probably null
R1646:Pzp UTSW 6 128503555 missense probably benign 0.33
R1770:Pzp UTSW 6 128485617 missense probably damaging 1.00
R1777:Pzp UTSW 6 128490572 missense possibly damaging 0.85
R1786:Pzp UTSW 6 128491161 splice site probably null
R1854:Pzp UTSW 6 128502225 missense probably damaging 1.00
R2001:Pzp UTSW 6 128516120 missense probably benign 0.01
R2060:Pzp UTSW 6 128483710 missense probably benign 0.45
R2081:Pzp UTSW 6 128519420 missense probably benign 0.00
R2130:Pzp UTSW 6 128491161 splice site probably null
R2131:Pzp UTSW 6 128491161 splice site probably null
R2160:Pzp UTSW 6 128525276 missense probably damaging 1.00
R2168:Pzp UTSW 6 128488047 missense probably damaging 0.98
R2328:Pzp UTSW 6 128510390 missense possibly damaging 0.79
R2441:Pzp UTSW 6 128489768 nonsense probably null
R2866:Pzp UTSW 6 128525264 missense possibly damaging 0.76
R2869:Pzp UTSW 6 128485556 critical splice donor site probably null
R2869:Pzp UTSW 6 128485556 critical splice donor site probably null
R2870:Pzp UTSW 6 128485556 critical splice donor site probably null
R2870:Pzp UTSW 6 128485556 critical splice donor site probably null
R2873:Pzp UTSW 6 128485556 critical splice donor site probably null
R2876:Pzp UTSW 6 128491550 missense probably damaging 1.00
R3404:Pzp UTSW 6 128513806 missense probably damaging 1.00
R4461:Pzp UTSW 6 128524040 missense probably benign 0.02
R5103:Pzp UTSW 6 128502229 missense probably benign 0.04
R5193:Pzp UTSW 6 128502334 missense probably benign 0.00
R5425:Pzp UTSW 6 128489048 missense probably damaging 0.97
R5465:Pzp UTSW 6 128486961 missense probably damaging 1.00
R5590:Pzp UTSW 6 128523796 missense probably damaging 1.00
R5656:Pzp UTSW 6 128490072 missense probably damaging 0.99
R5697:Pzp UTSW 6 128525189 missense probably benign 0.03
R5854:Pzp UTSW 6 128506869 missense probably benign 0.01
R5994:Pzp UTSW 6 128491597 missense probably damaging 1.00
R6042:Pzp UTSW 6 128524014 missense possibly damaging 0.75
R6054:Pzp UTSW 6 128513764 missense probably benign 0.03
R6153:Pzp UTSW 6 128489016 missense probably benign
R6465:Pzp UTSW 6 128491619 missense probably damaging 1.00
R6719:Pzp UTSW 6 128524083 missense probably benign 0.17
R6722:Pzp UTSW 6 128487954 missense probably damaging 1.00
R7316:Pzp UTSW 6 128513773 missense probably damaging 0.99
R7453:Pzp UTSW 6 128486916 missense probably damaging 1.00
R7826:Pzp UTSW 6 128487533 missense probably benign 0.38
R7878:Pzp UTSW 6 128512311 missense possibly damaging 0.50
R7879:Pzp UTSW 6 128489016 missense probably benign
R8113:Pzp UTSW 6 128513731 splice site probably null
R8163:Pzp UTSW 6 128512194 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTGGAAAAGAATCCCAGGTGC -3'
(R):5'- CAGTGCCTTCTTCTTGGTTAAG -3'

Sequencing Primer
(F):5'- CCAGGTGCAAGAGAACAGCTATTTC -3'
(R):5'- GCTGTATTTCCAATCAAATGACCC -3'
Posted On2015-07-21