Incidental Mutation 'R4452:Klk1b11'
ID329006
Institutional Source Beutler Lab
Gene Symbol Klk1b11
Ensembl Gene ENSMUSG00000044485
Gene Namekallikrein 1-related peptidase b11
SynonymsKlk11, mGK-11
MMRRC Submission 041713-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R4452 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location43995877-43999875 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43995911 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 3 (F3I)
Ref Sequence ENSEMBL: ENSMUSP00000007156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007156]
Predicted Effect probably damaging
Transcript: ENSMUST00000007156
AA Change: F3I

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000007156
Gene: ENSMUSG00000044485
AA Change: F3I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 6.47e-101 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206787
Meta Mutation Damage Score 0.1293 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 A G 7: 119,698,574 T145A possibly damaging Het
Adgra1 G T 7: 139,852,521 A92S probably benign Het
Aim2 A G 1: 173,455,444 T31A possibly damaging Het
Cd46 G A 1: 195,085,360 A131V possibly damaging Het
Cdc27 A T 11: 104,517,395 M563K probably benign Het
Chd9 A T 8: 90,977,680 N721I probably damaging Het
Cnn2 A G 10: 79,991,442 D49G probably benign Het
Cul1 T A 6: 47,508,989 Y323* probably null Het
D5Ertd579e A G 5: 36,616,470 W194R probably damaging Het
Dhx15 G A 5: 52,166,732 P406L probably benign Het
Dnah9 C T 11: 66,027,082 A2249T probably damaging Het
Dppa4 T A 16: 48,289,336 D106E probably benign Het
Gja10 A G 4: 32,601,313 V357A probably benign Het
Gm20481 T G 17: 34,972,133 probably benign Het
Grxcr2 T C 18: 41,986,544 N244D probably damaging Het
Mid1 T C X: 169,927,425 V139A possibly damaging Het
Mycbp2 T C 14: 103,155,658 K3046E probably damaging Het
Nfasc T C 1: 132,634,671 N122S probably damaging Het
Olfr1099 C T 2: 86,958,699 G253D probably damaging Het
Olfr1232 T A 2: 89,325,253 D309V possibly damaging Het
Olfr556 T C 7: 102,670,049 V43A probably benign Het
Olfr655 T A 7: 104,596,639 M181L probably damaging Het
Olfr736 A T 14: 50,392,912 Y52F probably benign Het
Olfr933 T C 9: 38,976,086 S137P probably benign Het
P2ry10b C T X: 107,171,118 T28I probably damaging Het
Pdxdc1 T C 16: 13,837,126 Y675C possibly damaging Het
Plcl1 A G 1: 55,696,886 N462S probably benign Het
Ptf1a G T 2: 19,446,281 A141S possibly damaging Het
Pzp A G 6: 128,491,240 L1028P probably damaging Het
Qrsl1 A G 10: 43,882,162 S312P probably damaging Het
Sars2 A G 7: 28,750,093 T349A probably benign Het
Scarb1 A T 5: 125,300,345 F208I probably damaging Het
Scn8a A G 15: 100,957,091 N153S possibly damaging Het
Sema4c A T 1: 36,553,756 V127D probably benign Het
Smg6 C G 11: 74,990,141 S931C probably benign Het
Trpm2 A T 10: 77,923,593 L1119Q probably damaging Het
Ubtd2 T A 11: 32,499,406 N84K probably damaging Het
Ugt2b35 A T 5: 87,003,378 H281L probably damaging Het
Umodl1 T C 17: 30,994,815 probably null Het
Other mutations in Klk1b11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Klk1b11 APN 7 43999819 missense probably damaging 1.00
IGL01501:Klk1b11 APN 7 43999834 utr 3 prime probably benign
IGL02054:Klk1b11 APN 7 43998827 missense possibly damaging 0.90
IGL02267:Klk1b11 APN 7 43999741 missense probably damaging 1.00
R0125:Klk1b11 UTSW 7 43999051 missense probably benign 0.10
R0449:Klk1b11 UTSW 7 43997792 missense probably damaging 1.00
R0708:Klk1b11 UTSW 7 43997728 missense possibly damaging 0.59
R4361:Klk1b11 UTSW 7 43995954 splice site probably null
R5120:Klk1b11 UTSW 7 43999022 missense probably benign 0.29
R5214:Klk1b11 UTSW 7 43997842 missense probably benign 0.02
R5219:Klk1b11 UTSW 7 43999696 missense probably damaging 1.00
R6348:Klk1b11 UTSW 7 43997851 critical splice donor site probably null
R6803:Klk1b11 UTSW 7 43997837 missense probably damaging 1.00
R7065:Klk1b11 UTSW 7 43998962 missense probably benign 0.22
R7172:Klk1b11 UTSW 7 43999247 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCCAATTCCACAGCCAGGAG -3'
(R):5'- CTGGAAAGTGGGATTGGACC -3'

Sequencing Primer
(F):5'- GGGTGCAAGCAGGGAGTCC -3'
(R):5'- CATCTGTCCTGAGAGCAAGGACTG -3'
Posted On2015-07-21