Mutagenetix > Incidental Mutations

Incidental Mutation 'R4452:Mycbp2'

329023

Institutional Source

Beutler Lab

Gene Symbol

Mycbp2

Ensembl Gene

ENSMUSG00000033004

Gene Name

MYC binding protein 2

Synonyms

C130061D10Rik, Phr1, Pam

MMRRC Submission

041713-MU

Accession Numbers

Genbank: NM_207215; MGI: 2179432

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4452 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103113411-103346814 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 103155658 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 3046 (K3046E)

Ref Sequence

ENSEMBL: ENSMUSP00000124601 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159855] [ENSMUST00000160758]

Predicted Effect

probably damaging
Transcript: ENSMUST00000159855
AA Change: K3156E

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000124710
Gene: ENSMUSG00000033004
AA Change: K3156E

Domain	Start	End	E-Value	Type
low complexity region	5	27	N/A	INTRINSIC
low complexity region	47	55	N/A	INTRINSIC
low complexity region	100	127	N/A	INTRINSIC
low complexity region	178	191	N/A	INTRINSIC
Pfam:RCC1_2	683	712	1.4e-10	PFAM
low complexity region	737	750	N/A	INTRINSIC
low complexity region	793	815	N/A	INTRINSIC
Pfam:RCC1_2	942	971	5.5e-10	PFAM
Pfam:RCC1	958	1006	4.8e-15	PFAM
Pfam:PHR	1235	1385	8.2e-44	PFAM
Pfam:PHR	1723	1880	1.4e-43	PFAM
low complexity region	1935	1948	N/A	INTRINSIC
low complexity region	2182	2195	N/A	INTRINSIC
Pfam:Filamin	2261	2431	7.5e-9	PFAM
Pfam:SH3_3	2472	2539	4.1e-9	PFAM
internal_repeat_3	2612	2679	1.69e-7	PROSPERO
low complexity region	2701	2710	N/A	INTRINSIC
low complexity region	2884	2917	N/A	INTRINSIC
low complexity region	2970	2984	N/A	INTRINSIC
coiled coil region	3263	3290	N/A	INTRINSIC
low complexity region	3352	3365	N/A	INTRINSIC
low complexity region	3418	3433	N/A	INTRINSIC
low complexity region	3678	3695	N/A	INTRINSIC
APC10	3810	3968	1.11e-18	SMART
low complexity region	4103	4115	N/A	INTRINSIC
low complexity region	4190	4212	N/A	INTRINSIC
Blast:BBOX	4327	4370	7e-7	BLAST
RING	4496	4546	5.35e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000160758
AA Change: K3046E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000124601
Gene: ENSMUSG00000033004
AA Change: K3046E

Domain	Start	End	E-Value	Type
low complexity region	14	22	N/A	INTRINSIC
low complexity region	67	94	N/A	INTRINSIC
low complexity region	145	158	N/A	INTRINSIC
Pfam:RCC1_2	650	679	1e-10	PFAM
low complexity region	704	717	N/A	INTRINSIC
low complexity region	760	782	N/A	INTRINSIC
Pfam:RCC1_2	909	938	1.5e-9	PFAM
Pfam:RCC1	925	973	1.3e-15	PFAM
Pfam:PHR	1202	1353	1.6e-50	PFAM
Pfam:PHR	1690	1848	3.1e-58	PFAM
low complexity region	1902	1915	N/A	INTRINSIC
low complexity region	2149	2162	N/A	INTRINSIC
Pfam:Filamin	2228	2398	7.6e-9	PFAM
Pfam:SH3_3	2439	2507	2.3e-10	PFAM
internal_repeat_3	2554	2621	2e-7	PROSPERO
low complexity region	2643	2652	N/A	INTRINSIC
low complexity region	2774	2807	N/A	INTRINSIC
low complexity region	2860	2874	N/A	INTRINSIC
coiled coil region	3153	3180	N/A	INTRINSIC
low complexity region	3242	3255	N/A	INTRINSIC
low complexity region	3308	3323	N/A	INTRINSIC
low complexity region	3568	3585	N/A	INTRINSIC
APC10	3700	3858	1.11e-18	SMART
low complexity region	3993	4005	N/A	INTRINSIC
low complexity region	4080	4102	N/A	INTRINSIC
Blast:BBOX	4217	4260	7e-7	BLAST
RING	4386	4436	5.35e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000161008

SMART Domains

Protein: ENSMUSP00000124443
Gene: ENSMUSG00000033004

Domain	Start	End	E-Value	Type
low complexity region	66	79	N/A	INTRINSIC
low complexity region	132	147	N/A	INTRINSIC
low complexity region	392	409	N/A	INTRINSIC
APC10	524	682	1.11e-18	SMART
low complexity region	820	832	N/A	INTRINSIC
low complexity region	907	929	N/A	INTRINSIC
Blast:BBOX	1042	1085	2e-6	BLAST
RING	1213	1263	5.35e-5	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000161278
AA Change: K756E

SMART Domains

Protein: ENSMUSP00000125189
Gene: ENSMUSG00000033004
AA Change: K756E

Domain	Start	End	E-Value	Type
Blast:IG_FLMN	2	66	1e-37	BLAST
SCOP:d1qfha1	14	64	2e-7	SMART
Pfam:SH3_3	98	165	5.8e-10	PFAM
internal_repeat_1	213	280	8.77e-8	PROSPERO
low complexity region	302	311	N/A	INTRINSIC
low complexity region	485	518	N/A	INTRINSIC
low complexity region	571	585	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162762

Meta Mutation Damage Score

0.2369

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 95.0%

Validation Efficiency

98% (48/49)

MGI Phenotype

PHENOTYPE: Mice homozygous for a targeted allele exhibit neonatal lethality, defective diaphragm innervation, abnormal brain morphology and defective axonal guidance. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(5) Chemically induced(3)

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm4	A	G	7: 119,698,574	T145A	possibly damaging	Het
Adgra1	G	T	7: 139,852,521	A92S	probably benign	Het
Aim2	A	G	1: 173,455,444	T31A	possibly damaging	Het
Cd46	G	A	1: 195,085,360	A131V	possibly damaging	Het
Cdc27	A	T	11: 104,517,395	M563K	probably benign	Het
Chd9	A	T	8: 90,977,680	N721I	probably damaging	Het
Cnn2	A	G	10: 79,991,442	D49G	probably benign	Het
Cul1	T	A	6: 47,508,989	Y323*	probably null	Het
D5Ertd579e	A	G	5: 36,616,470	W194R	probably damaging	Het
Dhx15	G	A	5: 52,166,732	P406L	probably benign	Het
Dnah9	C	T	11: 66,027,082	A2249T	probably damaging	Het
Dppa4	T	A	16: 48,289,336	D106E	probably benign	Het
Gja10	A	G	4: 32,601,313	V357A	probably benign	Het
Gm20481	T	G	17: 34,972,133		probably benign	Het
Grxcr2	T	C	18: 41,986,544	N244D	probably damaging	Het
Klk1b11	T	A	7: 43,995,911	F3I	probably damaging	Het
Mid1	T	C	X: 169,927,425	V139A	possibly damaging	Het
Nfasc	T	C	1: 132,634,671	N122S	probably damaging	Het
Olfr1099	C	T	2: 86,958,699	G253D	probably damaging	Het
Olfr1232	T	A	2: 89,325,253	D309V	possibly damaging	Het
Olfr556	T	C	7: 102,670,049	V43A	probably benign	Het
Olfr655	T	A	7: 104,596,639	M181L	probably damaging	Het
Olfr736	A	T	14: 50,392,912	Y52F	probably benign	Het
Olfr933	T	C	9: 38,976,086	S137P	probably benign	Het
P2ry10b	C	T	X: 107,171,118	T28I	probably damaging	Het
Pdxdc1	T	C	16: 13,837,126	Y675C	possibly damaging	Het
Plcl1	A	G	1: 55,696,886	N462S	probably benign	Het
Ptf1a	G	T	2: 19,446,281	A141S	possibly damaging	Het
Pzp	A	G	6: 128,491,240	L1028P	probably damaging	Het
Qrsl1	A	G	10: 43,882,162	S312P	probably damaging	Het
Sars2	A	G	7: 28,750,093	T349A	probably benign	Het
Scarb1	A	T	5: 125,300,345	F208I	probably damaging	Het
Scn8a	A	G	15: 100,957,091	N153S	possibly damaging	Het
Sema4c	A	T	1: 36,553,756	V127D	probably benign	Het
Smg6	C	G	11: 74,990,141	S931C	probably benign	Het
Trpm2	A	T	10: 77,923,593	L1119Q	probably damaging	Het
Ubtd2	T	A	11: 32,499,406	N84K	probably damaging	Het
Ugt2b35	A	T	5: 87,003,378	H281L	probably damaging	Het
Umodl1	T	C	17: 30,994,815		probably null	Het

Other mutations in Mycbp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Mycbp2	APN	14	103223050	missense	probably damaging	1.00
IGL00518:Mycbp2	APN	14	103155808	missense	probably damaging	1.00
IGL00650:Mycbp2	APN	14	103143228	missense	probably damaging	0.97
IGL00653:Mycbp2	APN	14	103143228	missense	probably damaging	0.97
IGL00742:Mycbp2	APN	14	103201352	missense	probably damaging	1.00
IGL00755:Mycbp2	APN	14	103194621	missense	possibly damaging	0.72
IGL00793:Mycbp2	APN	14	103126753	missense	possibly damaging	0.77
IGL00916:Mycbp2	APN	14	103291283	splice site	probably benign
IGL00960:Mycbp2	APN	14	103229384	missense	possibly damaging	0.95
IGL00977:Mycbp2	APN	14	103172642	missense	probably damaging	0.98
IGL01349:Mycbp2	APN	14	103122547	missense	probably damaging	0.98
IGL01369:Mycbp2	APN	14	103155510	missense	possibly damaging	0.61
IGL01410:Mycbp2	APN	14	103229492	splice site	probably null
IGL01586:Mycbp2	APN	14	103140869	critical splice donor site	probably null
IGL01593:Mycbp2	APN	14	103291287	critical splice donor site	probably null
IGL01693:Mycbp2	APN	14	103127979	missense	probably damaging	0.99
IGL01730:Mycbp2	APN	14	103135204	nonsense	probably null
IGL01820:Mycbp2	APN	14	103188501	missense	probably damaging	1.00
IGL01974:Mycbp2	APN	14	103143211	missense	possibly damaging	0.88
IGL02071:Mycbp2	APN	14	103154907	nonsense	probably null
IGL02178:Mycbp2	APN	14	103224366	missense	probably benign	0.01
IGL02324:Mycbp2	APN	14	103242207	missense	probably damaging	1.00
IGL02442:Mycbp2	APN	14	103314375	missense	probably benign
IGL02607:Mycbp2	APN	14	103285273	missense	probably damaging	1.00
IGL02679:Mycbp2	APN	14	103205185	missense	probably benign
IGL02702:Mycbp2	APN	14	103220124	missense	probably benign	0.01
IGL02709:Mycbp2	APN	14	103155261	missense	probably damaging	0.97
IGL02736:Mycbp2	APN	14	103114242	splice site	probably benign
IGL02866:Mycbp2	APN	14	103129992	missense	probably damaging	0.98
IGL02939:Mycbp2	APN	14	103177279	missense	probably benign
IGL03082:Mycbp2	APN	14	103204369	missense	probably benign	0.23
IGL03142:Mycbp2	APN	14	103298776	missense	probably damaging	0.99
IGL03155:Mycbp2	APN	14	103155453	missense	probably benign	0.06
IGL03236:Mycbp2	APN	14	103298698	missense	probably damaging	0.99
IGL03256:Mycbp2	APN	14	103188589	missense	possibly damaging	0.92
IGL03303:Mycbp2	APN	14	103247758	missense	probably damaging	1.00
decompose	UTSW	14	103219979	missense	probably benign	0.12
moulder	UTSW	14	103188592	missense	probably damaging	1.00
N/A - 293:Mycbp2	UTSW	14	103224462	splice site	probably benign
R0040:Mycbp2	UTSW	14	103224272	missense	probably benign	0.11
R0040:Mycbp2	UTSW	14	103224272	missense	probably benign	0.11
R0057:Mycbp2	UTSW	14	103152142	missense	probably damaging	0.97
R0063:Mycbp2	UTSW	14	103156634	unclassified	probably benign
R0097:Mycbp2	UTSW	14	103155762	missense	probably damaging	1.00
R0097:Mycbp2	UTSW	14	103155762	missense	probably damaging	1.00
R0268:Mycbp2	UTSW	14	103314325	nonsense	probably null
R0388:Mycbp2	UTSW	14	103156667	missense	probably benign	0.01
R0410:Mycbp2	UTSW	14	103135133	missense	probably damaging	1.00
R0530:Mycbp2	UTSW	14	103182459	missense	probably damaging	1.00
R0591:Mycbp2	UTSW	14	103196391	unclassified	probably benign
R0671:Mycbp2	UTSW	14	103194588	missense	possibly damaging	0.95
R0755:Mycbp2	UTSW	14	103174794	missense	probably damaging	1.00
R0817:Mycbp2	UTSW	14	103229418	missense	probably damaging	0.99
R0818:Mycbp2	UTSW	14	103229418	missense	probably damaging	0.99
R0819:Mycbp2	UTSW	14	103229418	missense	probably damaging	0.99
R0881:Mycbp2	UTSW	14	103220013	missense	probably benign
R0903:Mycbp2	UTSW	14	103275857	missense	probably damaging	0.99
R0940:Mycbp2	UTSW	14	103262693	unclassified	probably benign
R0961:Mycbp2	UTSW	14	103184835	missense	probably damaging	1.00
R1004:Mycbp2	UTSW	14	103140917	missense	probably benign	0.00
R1138:Mycbp2	UTSW	14	103174826	missense	possibly damaging	0.84
R1170:Mycbp2	UTSW	14	103200152	nonsense	probably null
R1211:Mycbp2	UTSW	14	103120563	missense	probably benign	0.31
R1268:Mycbp2	UTSW	14	103208782	missense	probably damaging	1.00
R1298:Mycbp2	UTSW	14	103155898	missense	probably damaging	1.00
R1341:Mycbp2	UTSW	14	103298867	splice site	probably benign
R1469:Mycbp2	UTSW	14	103188520	missense	probably damaging	0.99
R1469:Mycbp2	UTSW	14	103188520	missense	probably damaging	0.99
R1513:Mycbp2	UTSW	14	103204389	missense	probably damaging	1.00
R1528:Mycbp2	UTSW	14	103232597	missense	possibly damaging	0.91
R1564:Mycbp2	UTSW	14	103169851	splice site	probably null
R1565:Mycbp2	UTSW	14	103252509	missense	possibly damaging	0.82
R1656:Mycbp2	UTSW	14	103247758	missense	probably damaging	1.00
R1694:Mycbp2	UTSW	14	103227511	missense	probably damaging	1.00
R1709:Mycbp2	UTSW	14	103224416	missense	probably damaging	1.00
R1728:Mycbp2	UTSW	14	103155178	missense	probably damaging	0.98
R1751:Mycbp2	UTSW	14	103248405	missense	probably damaging	0.98
R1767:Mycbp2	UTSW	14	103248405	missense	probably damaging	0.98
R1772:Mycbp2	UTSW	14	103182419	missense	probably damaging	1.00
R1784:Mycbp2	UTSW	14	103155178	missense	probably damaging	0.98
R1823:Mycbp2	UTSW	14	103252509	missense	possibly damaging	0.82
R1824:Mycbp2	UTSW	14	103252509	missense	possibly damaging	0.82
R1844:Mycbp2	UTSW	14	103155714	missense	possibly damaging	0.94
R1916:Mycbp2	UTSW	14	103184883	missense	probably damaging	1.00
R1944:Mycbp2	UTSW	14	103229404	missense	probably damaging	1.00
R1983:Mycbp2	UTSW	14	103145971	missense	probably damaging	0.97
R2002:Mycbp2	UTSW	14	103248403	missense	probably damaging	0.98
R2031:Mycbp2	UTSW	14	103188592	missense	probably damaging	1.00
R2035:Mycbp2	UTSW	14	103260239	missense	probably damaging	1.00
R2048:Mycbp2	UTSW	14	103232524	critical splice donor site	probably null
R2061:Mycbp2	UTSW	14	103287260	missense	probably damaging	0.99
R2113:Mycbp2	UTSW	14	103220076	missense	probably damaging	0.99
R2128:Mycbp2	UTSW	14	103201230	missense	probably benign	0.01
R2134:Mycbp2	UTSW	14	103208893	missense	probably damaging	1.00
R2135:Mycbp2	UTSW	14	103145942	missense	probably benign
R2135:Mycbp2	UTSW	14	103208893	missense	probably damaging	1.00
R2146:Mycbp2	UTSW	14	103155922	missense	probably damaging	0.97
R2147:Mycbp2	UTSW	14	103155922	missense	probably damaging	0.97
R2148:Mycbp2	UTSW	14	103155922	missense	probably damaging	0.97
R2150:Mycbp2	UTSW	14	103155922	missense	probably damaging	0.97
R2163:Mycbp2	UTSW	14	103169855	critical splice donor site	probably null
R2248:Mycbp2	UTSW	14	103169859	missense	possibly damaging	0.50
R2265:Mycbp2	UTSW	14	103262749	missense	probably benign	0.39
R2272:Mycbp2	UTSW	14	103144338	missense	probably null	0.66
R2379:Mycbp2	UTSW	14	103174950	missense	probably benign
R2495:Mycbp2	UTSW	14	103200118	missense	probably damaging	0.99
R2508:Mycbp2	UTSW	14	103131245	missense	probably damaging	0.99
R2510:Mycbp2	UTSW	14	103155255	missense	probably damaging	0.96
R2851:Mycbp2	UTSW	14	103144333	missense	probably damaging	0.99
R2852:Mycbp2	UTSW	14	103144333	missense	probably damaging	0.99
R2965:Mycbp2	UTSW	14	103297358	missense	probably benign	0.00
R3156:Mycbp2	UTSW	14	103208743	splice site	probably benign
R3404:Mycbp2	UTSW	14	103200114	missense	probably damaging	0.99
R3410:Mycbp2	UTSW	14	103135117	missense	probably damaging	1.00
R3429:Mycbp2	UTSW	14	103229430	missense	probably damaging	1.00
R3706:Mycbp2	UTSW	14	103156414	missense	probably benign	0.31
R3772:Mycbp2	UTSW	14	103133788	missense	possibly damaging	0.82
R3778:Mycbp2	UTSW	14	103197285	missense	probably damaging	0.99
R3883:Mycbp2	UTSW	14	103295250	missense	probably damaging	0.97
R3884:Mycbp2	UTSW	14	103295250	missense	probably damaging	0.97
R3887:Mycbp2	UTSW	14	103174797	missense	probably damaging	0.98
R3923:Mycbp2	UTSW	14	103126713	missense	probably damaging	1.00
R3926:Mycbp2	UTSW	14	103204500	missense	probably damaging	1.00
R3959:Mycbp2	UTSW	14	103295252	missense	probably benign	0.00
R3966:Mycbp2	UTSW	14	103138725	splice site	probably benign
R4021:Mycbp2	UTSW	14	103152157	missense	probably damaging	0.97
R4363:Mycbp2	UTSW	14	103248457	missense	probably damaging	1.00
R4405:Mycbp2	UTSW	14	103123445	missense	probably damaging	1.00
R4407:Mycbp2	UTSW	14	103287228	missense	probably damaging	1.00
R4410:Mycbp2	UTSW	14	103135266	missense	probably damaging	1.00
R4434:Mycbp2	UTSW	14	103133789	missense	probably damaging	0.99
R4448:Mycbp2	UTSW	14	103188502	missense	possibly damaging	0.89
R4573:Mycbp2	UTSW	14	103346297	missense	probably benign	0.05
R4589:Mycbp2	UTSW	14	103177313	missense	probably benign	0.04
R4621:Mycbp2	UTSW	14	103219979	missense	probably benign	0.12
R4622:Mycbp2	UTSW	14	103219979	missense	probably benign	0.12
R4729:Mycbp2	UTSW	14	103188591	missense	probably damaging	1.00
R4770:Mycbp2	UTSW	14	103219944	missense	probably benign	0.41
R4790:Mycbp2	UTSW	14	103229437	missense	probably damaging	1.00
R4884:Mycbp2	UTSW	14	103211295	missense	probably damaging	1.00
R4885:Mycbp2	UTSW	14	103145946	missense	possibly damaging	0.86
R4956:Mycbp2	UTSW	14	103287239	missense	probably damaging	0.99
R4980:Mycbp2	UTSW	14	103260385	splice site	probably null
R4994:Mycbp2	UTSW	14	103169994	missense	probably benign
R5029:Mycbp2	UTSW	14	103156510	missense	probably benign	0.21
R5038:Mycbp2	UTSW	14	103296939	missense	probably damaging	1.00
R5044:Mycbp2	UTSW	14	103139235	critical splice donor site	probably null
R5231:Mycbp2	UTSW	14	103346214	critical splice donor site	probably null
R5305:Mycbp2	UTSW	14	103346321	missense	probably benign	0.00
R5322:Mycbp2	UTSW	14	103185683	critical splice acceptor site	probably null
R5376:Mycbp2	UTSW	14	103242432	nonsense	probably null
R5414:Mycbp2	UTSW	14	103306261	missense	probably damaging	1.00
R5453:Mycbp2	UTSW	14	103201401	missense	probably damaging	0.99
R5462:Mycbp2	UTSW	14	103200126	missense	probably damaging	1.00
R5499:Mycbp2	UTSW	14	103242179	missense	probably damaging	1.00
R5502:Mycbp2	UTSW	14	103173814	missense	probably damaging	1.00
R5524:Mycbp2	UTSW	14	103295237	missense	probably damaging	1.00
R5533:Mycbp2	UTSW	14	103282645	nonsense	probably null
R5569:Mycbp2	UTSW	14	103135243	missense	probably damaging	1.00
R5574:Mycbp2	UTSW	14	103142767	missense	possibly damaging	0.94
R5579:Mycbp2	UTSW	14	103291333	missense	probably damaging	0.98
R5590:Mycbp2	UTSW	14	103123355	missense	probably damaging	1.00
R5592:Mycbp2	UTSW	14	103194677	missense	probably benign	0.02
R5643:Mycbp2	UTSW	14	103287334	missense	probably damaging	1.00
R5644:Mycbp2	UTSW	14	103287334	missense	probably damaging	1.00
R5645:Mycbp2	UTSW	14	103188608	missense	probably damaging	1.00
R5645:Mycbp2	UTSW	14	103188615	critical splice acceptor site	probably null
R5646:Mycbp2	UTSW	14	103169910	missense	probably benign	0.09
R5648:Mycbp2	UTSW	14	103291342	missense	probably damaging	1.00
R5651:Mycbp2	UTSW	14	103282665	missense	probably null	0.99
R5668:Mycbp2	UTSW	14	103120519	missense	possibly damaging	0.62
R5745:Mycbp2	UTSW	14	103156453	missense	possibly damaging	0.94
R5751:Mycbp2	UTSW	14	103148550	missense	probably damaging	0.99
R5756:Mycbp2	UTSW	14	103133974	missense	probably damaging	0.99
R5837:Mycbp2	UTSW	14	103124403	missense	probably damaging	1.00
R5984:Mycbp2	UTSW	14	103126684	missense	probably damaging	0.98
R6005:Mycbp2	UTSW	14	103156723	missense	probably benign
R6063:Mycbp2	UTSW	14	103135146	missense	probably damaging	1.00
R6091:Mycbp2	UTSW	14	103223046	missense	probably damaging	1.00
R6120:Mycbp2	UTSW	14	103275887	missense	probably benign	0.01
R6129:Mycbp2	UTSW	14	103285400	missense	probably benign	0.21
R6147:Mycbp2	UTSW	14	103155509	nonsense	probably null
R6161:Mycbp2	UTSW	14	103298747	missense	probably damaging	1.00
R6187:Mycbp2	UTSW	14	103147017	missense	probably damaging	1.00
R6208:Mycbp2	UTSW	14	103295228	missense	probably benign	0.11
R6228:Mycbp2	UTSW	14	103260229	missense	probably benign	0.24
R6301:Mycbp2	UTSW	14	103155426	missense	probably damaging	1.00
R6311:Mycbp2	UTSW	14	103262740	missense	possibly damaging	0.93
R6329:Mycbp2	UTSW	14	103155852	missense	probably benign	0.00
R6439:Mycbp2	UTSW	14	103155475	missense	probably benign	0.00
R6462:Mycbp2	UTSW	14	103136557	critical splice donor site	probably null
R6528:Mycbp2	UTSW	14	103142881	missense	probably damaging	0.99
R6736:Mycbp2	UTSW	14	103191567	missense	probably null	1.00
R6821:Mycbp2	UTSW	14	103139409	missense	probably damaging	1.00
R6851:Mycbp2	UTSW	14	103260194	critical splice donor site	probably null
R6948:Mycbp2	UTSW	14	103285267	missense	possibly damaging	0.94
R6977:Mycbp2	UTSW	14	103154906	missense	probably damaging	0.99
R6985:Mycbp2	UTSW	14	103206681	missense	possibly damaging	0.79
R7035:Mycbp2	UTSW	14	103174981	missense	probably benign
R7054:Mycbp2	UTSW	14	103156098	missense	possibly damaging	0.90
R7108:Mycbp2	UTSW	14	103122603	missense	probably damaging	1.00
R7117:Mycbp2	UTSW	14	103154077	missense	probably benign	0.21
R7137:Mycbp2	UTSW	14	103282679	missense	possibly damaging	0.94
R7169:Mycbp2	UTSW	14	103260200	missense	possibly damaging	0.78
R7218:Mycbp2	UTSW	14	103133846	missense	probably benign
R7234:Mycbp2	UTSW	14	103215337	missense	probably damaging	0.98
R7238:Mycbp2	UTSW	14	103156297	missense	probably damaging	1.00
R7244:Mycbp2	UTSW	14	103208909	missense	probably damaging	0.98
R7265:Mycbp2	UTSW	14	103197243	critical splice donor site	probably null
R7286:Mycbp2	UTSW	14	103120591	missense	probably damaging	1.00
R7332:Mycbp2	UTSW	14	103156453	missense	probably damaging	1.00
R7332:Mycbp2	UTSW	14	103197357	missense	probably damaging	0.97
R7384:Mycbp2	UTSW	14	103276393	missense	probably damaging	0.99
R7392:Mycbp2	UTSW	14	103152191	missense	probably damaging	1.00
R7392:Mycbp2	UTSW	14	103243128	missense	probably damaging	0.99
R7409:Mycbp2	UTSW	14	103288744	missense	probably damaging	1.00
R7486:Mycbp2	UTSW	14	103197254	missense	probably damaging	0.97
R7643:Mycbp2	UTSW	14	103346265	missense	probably benign
R7661:Mycbp2	UTSW	14	103212623	missense	probably damaging	1.00
R7663:Mycbp2	UTSW	14	103191609	missense	probably damaging	0.99
R7730:Mycbp2	UTSW	14	103123355	missense	probably damaging	0.99
R7757:Mycbp2	UTSW	14	103191619	missense	probably damaging	1.00
R7773:Mycbp2	UTSW	14	103248404	missense	probably damaging	0.97
R7787:Mycbp2	UTSW	14	103127097	missense	probably damaging	1.00
R7822:Mycbp2	UTSW	14	103139415	missense	probably benign	0.00
R7838:Mycbp2	UTSW	14	103177293	missense	probably benign	0.10
R7841:Mycbp2	UTSW	14	103146831	critical splice donor site	probably null
R7858:Mycbp2	UTSW	14	103156305	missense	probably damaging	1.00
R7873:Mycbp2	UTSW	14	103156146	missense	probably damaging	1.00
R7911:Mycbp2	UTSW	14	103200185	missense	probably damaging	0.99
R7942:Mycbp2	UTSW	14	103155238	missense	probably damaging	0.99
R7951:Mycbp2	UTSW	14	103215462	missense	probably damaging	0.99
R7958:Mycbp2	UTSW	14	103129964	missense	probably benign	0.00
R8235:Mycbp2	UTSW	14	103198674	missense	probably damaging	0.99
R8246:Mycbp2	UTSW	14	103155204	missense	probably damaging	0.99
R8338:Mycbp2	UTSW	14	103135265	missense	probably damaging	1.00
R8343:Mycbp2	UTSW	14	103160675	splice site	probably null
R8361:Mycbp2	UTSW	14	103138814	missense	probably damaging	1.00
R8490:Mycbp2	UTSW	14	103208831	missense	probably benign	0.00
R8524:Mycbp2	UTSW	14	103155459	missense	probably benign	0.23
R8525:Mycbp2	UTSW	14	103212719	missense	probably damaging	1.00
R8735:Mycbp2	UTSW	14	103223150	missense	probably damaging	0.99
X0024:Mycbp2	UTSW	14	103146942	missense	probably damaging	1.00
Z1176:Mycbp2	UTSW	14	103156637	missense	probably benign	0.06
Z1176:Mycbp2	UTSW	14	103346249	missense	probably benign
Z1177:Mycbp2	UTSW	14	103127063	critical splice donor site	probably null
Z1177:Mycbp2	UTSW	14	103135123	missense	probably damaging	1.00
Z1177:Mycbp2	UTSW	14	103169873	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- TGGACATTTCAAAAGTGGCTTCC -3'
(R):5'- TGGAACCAAATCTTTAGAACCAGC -3'

Sequencing Primer
(F):5'- AAAAGTGGCTTCCGATTTCCCG -3'
(R):5'- AAGCCATGTCCCCGTCTGTG -3'

Posted On

2015-07-21