Incidental Mutation 'R4453:Ppp1r1c'
ID329036
Institutional Source Beutler Lab
Gene Symbol Ppp1r1c
Ensembl Gene ENSMUSG00000034683
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 1C
Synonyms4930565M23Rik, 4930579P15Rik
MMRRC Submission 041152-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4453 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location79707780-79818496 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79708231 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 20 (I20V)
Ref Sequence ENSEMBL: ENSMUSP00000107410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040863] [ENSMUST00000090760] [ENSMUST00000111780]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040863
AA Change: I20V

PolyPhen 2 Score 0.789 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000042784
Gene: ENSMUSG00000034683
AA Change: I20V

DomainStartEndE-ValueType
Pfam:DARPP-32 1 75 2.4e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000090760
AA Change: I20V

PolyPhen 2 Score 0.789 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088265
Gene: ENSMUSG00000034683
AA Change: I20V

DomainStartEndE-ValueType
Pfam:DARPP-32 2 108 1.2e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111780
AA Change: I20V

PolyPhen 2 Score 0.789 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107410
Gene: ENSMUSG00000034683
AA Change: I20V

DomainStartEndE-ValueType
Pfam:DARPP-32 1 86 7.3e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141978
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein phosphatase-1 (PP1) is a major serine/threonine phosphatase that regulates a variety of cellular functions. PP1 consists of a catalytic subunit (see PPP1CA; MIM 176875) and regulatory subunits that determine the subcellular localization of PP1 or regulate its function. PPP1R1C belongs to a group of PP1 inhibitory subunits that are themselves regulated by phosphorylation (Wang et al., 2008 [PubMed 18310074]).[supplied by OMIM, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano7 A G 1: 93,394,353 D361G probably damaging Het
Atp10a TGGCGGCGGC TGGCGGC 7: 58,658,500 probably benign Het
Ccdc86 G T 19: 10,948,519 P239T probably damaging Het
Ces2h G A 8: 105,014,656 probably null Het
Ckap5 T A 2: 91,548,845 S43R probably damaging Het
Cpne6 G A 14: 55,512,597 V62M probably damaging Het
Dmbt1 T C 7: 131,040,934 C161R probably damaging Het
Dnajc10 T C 2: 80,346,623 S641P probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Grm2 G A 9: 106,653,879 T137I probably damaging Het
Gusb A G 5: 129,998,483 V327A possibly damaging Het
Helz C T 11: 107,672,629 Q1631* probably null Het
Hspa1a A G 17: 34,970,293 Y545H probably benign Het
Hus1 A T 11: 9,006,035 M166K probably damaging Het
Kcnh1 C A 1: 192,505,517 T762K probably damaging Het
Limd1 C A 9: 123,480,294 Q353K possibly damaging Het
Lipe T A 7: 25,397,690 K276I probably damaging Het
Ntpcr G A 8: 125,736,190 V49I probably benign Het
Olfr814 T C 10: 129,874,661 N32S probably null Het
Prdm13 G T 4: 21,679,464 A342E unknown Het
Prkd3 C A 17: 78,983,546 R180L probably damaging Het
Prune2 T C 19: 17,121,910 F1593L probably benign Het
Rims2 T A 15: 39,292,208 C95S probably damaging Het
Stard9 A G 2: 120,697,791 M1510V probably benign Het
Taf12 A G 4: 132,282,995 I92V probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tssk5 G A 15: 76,374,543 R48C probably benign Het
Wwtr1 T C 3: 57,575,259 probably null Het
Zfp286 C G 11: 62,780,204 G348R probably damaging Het
Zfp473 T A 7: 44,733,254 T552S probably damaging Het
Zzef1 T C 11: 72,872,639 F1371L probably benign Het
Other mutations in Ppp1r1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Ppp1r1c APN 2 79709897 critical splice acceptor site probably null
IGL03326:Ppp1r1c APN 2 79808383 missense probably benign 0.18
R5936:Ppp1r1c UTSW 2 79756454 missense possibly damaging 0.77
R6149:Ppp1r1c UTSW 2 79756466 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ACTTGCTCACGCTGGAATTAC -3'
(R):5'- AGCCAATTGTTCCCCAGTTC -3'

Sequencing Primer
(F):5'- ACGCTGGAATTACAGAGATTTATTAC -3'
(R):5'- GTTCACCCCAAACACGAGTG -3'
Posted On2015-07-21