Incidental Mutation 'R4453:Taf12'
ID329042
Institutional Source Beutler Lab
Gene Symbol Taf12
Ensembl Gene ENSMUSG00000028899
Gene NameTATA-box binding protein associated factor 12
SynonymsTaf2J, 20kDa, 2810422D08Rik
MMRRC Submission 041152-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R4453 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location132274375-132295766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 132282995 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 92 (I92V)
Ref Sequence ENSEMBL: ENSMUSP00000101583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030731] [ENSMUST00000105963]
Predicted Effect probably benign
Transcript: ENSMUST00000030731
AA Change: I40V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030731
Gene: ENSMUSG00000028899
AA Change: I40V

DomainStartEndE-ValueType
Pfam:CBFD_NFYB_HMF 58 120 2.4e-8 PFAM
Pfam:TFIID_20kDa 59 126 6.1e-40 PFAM
Pfam:Histone 61 123 6.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105963
AA Change: I92V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101583
Gene: ENSMUSG00000028899
AA Change: I92V

DomainStartEndE-ValueType
Pfam:CBFD_NFYB_HMF 110 172 5.9e-7 PFAM
Pfam:TFIID_20kDa 111 178 7.3e-39 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Control of transcription by RNA polymerase II involves the basal transcription machinery which is a collection of proteins. These proteins with RNA polymerase II, assemble into complexes which are modulated by transactivator proteins that bind to cis-regulatory elements located adjacent to the transcription start site. Some modulators interact directly with the basal complex, whereas others may act as bridging proteins linking transactivators to the basal transcription factors. Some of these associated factors are weakly attached while others are tightly associated with TBP in the TFIID complex. Among the latter are the TAF proteins. Different TAFs are predicted to mediate the function of distinct transcriptional activators for a variety of gene promoters and RNA polymerases. TAF12 interacts directly with TBP as well as with TAF2I. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano7 A G 1: 93,394,353 D361G probably damaging Het
Atp10a TGGCGGCGGC TGGCGGC 7: 58,658,500 probably benign Het
Ccdc86 G T 19: 10,948,519 P239T probably damaging Het
Ces2h G A 8: 105,014,656 probably null Het
Ckap5 T A 2: 91,548,845 S43R probably damaging Het
Cpne6 G A 14: 55,512,597 V62M probably damaging Het
Dmbt1 T C 7: 131,040,934 C161R probably damaging Het
Dnajc10 T C 2: 80,346,623 S641P probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Grm2 G A 9: 106,653,879 T137I probably damaging Het
Gusb A G 5: 129,998,483 V327A possibly damaging Het
Helz C T 11: 107,672,629 Q1631* probably null Het
Hspa1a A G 17: 34,970,293 Y545H probably benign Het
Hus1 A T 11: 9,006,035 M166K probably damaging Het
Kcnh1 C A 1: 192,505,517 T762K probably damaging Het
Limd1 C A 9: 123,480,294 Q353K possibly damaging Het
Lipe T A 7: 25,397,690 K276I probably damaging Het
Ntpcr G A 8: 125,736,190 V49I probably benign Het
Olfr814 T C 10: 129,874,661 N32S probably null Het
Ppp1r1c A G 2: 79,708,231 I20V possibly damaging Het
Prdm13 G T 4: 21,679,464 A342E unknown Het
Prkd3 C A 17: 78,983,546 R180L probably damaging Het
Prune2 T C 19: 17,121,910 F1593L probably benign Het
Rims2 T A 15: 39,292,208 C95S probably damaging Het
Stard9 A G 2: 120,697,791 M1510V probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tssk5 G A 15: 76,374,543 R48C probably benign Het
Wwtr1 T C 3: 57,575,259 probably null Het
Zfp286 C G 11: 62,780,204 G348R probably damaging Het
Zfp473 T A 7: 44,733,254 T552S probably damaging Het
Zzef1 T C 11: 72,872,639 F1371L probably benign Het
Other mutations in Taf12
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3729:Taf12 UTSW 4 132282954 missense probably damaging 1.00
R6796:Taf12 UTSW 4 132289414 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ACAGCTGATTGGCCTTGGTC -3'
(R):5'- CAGACCTGACACTGTAGACAATAATTC -3'

Sequencing Primer
(F):5'- TTGGTCCTCACAGCTCTAAAAAG -3'
(R):5'- TTCAATAAAACTGGTAGAGTGGAAG -3'
Posted On2015-07-21