Mutagenetix > Incidental Mutations

Incidental Mutation 'R4453:Atp10a'

329046

Institutional Source

Beutler Lab

Gene Symbol

Atp10a

Ensembl Gene

ENSMUSG00000025324

Gene Name

ATPase, class V, type 10A

Synonyms

Atp10c, pfatp

MMRRC Submission

041152-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.092) question?

Stock #

R4453 (G1)

Quality Score

167

Status

Not validated

Chromosome

Chromosomal Location

58656166-58829420 bp(+) (GRCm38)

Type of Mutation

small deletion (1 aa in frame mutation)

DNA Base Change (assembly)

TGGCGGCGGC to TGGCGGC at 58658500 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000146388 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168747] [ENSMUST00000207668]

Predicted Effect

probably benign
Transcript: ENSMUST00000168747

SMART Domains

Protein: ENSMUSP00000129811
Gene: ENSMUSG00000025324

Domain	Start	End	E-Value	Type
low complexity region	15	32	N/A	INTRINSIC
Pfam:PhoLip_ATPase_N	55	114	5.2e-23	PFAM
Pfam:E1-E2_ATPase	120	393	6.6e-10	PFAM
low complexity region	633	643	N/A	INTRINSIC
Pfam:Cation_ATPase	685	791	1.5e-7	PFAM
Pfam:HAD	697	1054	2.1e-12	PFAM
Pfam:PhoLip_ATPase_C	1071	1316	1.1e-76	PFAM
low complexity region	1458	1477	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000207668

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. This gene is maternally expressed. It maps within the most common interval of deletion responsible for Angelman syndrome, also known as 'happy puppet syndrome'. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene at the distal end of the p^23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ano7	A	G	1: 93,394,353	D361G	probably damaging	Het
Ccdc86	G	T	19: 10,948,519	P239T	probably damaging	Het
Ces2h	G	A	8: 105,014,656		probably null	Het
Ckap5	T	A	2: 91,548,845	S43R	probably damaging	Het
Cpne6	G	A	14: 55,512,597	V62M	probably damaging	Het
Dmbt1	T	C	7: 131,040,934	C161R	probably damaging	Het
Dnajc10	T	C	2: 80,346,623	S641P	probably damaging	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Grm2	G	A	9: 106,653,879	T137I	probably damaging	Het
Gusb	A	G	5: 129,998,483	V327A	possibly damaging	Het
Helz	C	T	11: 107,672,629	Q1631*	probably null	Het
Hspa1a	A	G	17: 34,970,293	Y545H	probably benign	Het
Hus1	A	T	11: 9,006,035	M166K	probably damaging	Het
Kcnh1	C	A	1: 192,505,517	T762K	probably damaging	Het
Limd1	C	A	9: 123,480,294	Q353K	possibly damaging	Het
Lipe	T	A	7: 25,397,690	K276I	probably damaging	Het
Ntpcr	G	A	8: 125,736,190	V49I	probably benign	Het
Olfr814	T	C	10: 129,874,661	N32S	probably null	Het
Ppp1r1c	A	G	2: 79,708,231	I20V	possibly damaging	Het
Prdm13	G	T	4: 21,679,464	A342E	unknown	Het
Prkd3	C	A	17: 78,983,546	R180L	probably damaging	Het
Prune2	T	C	19: 17,121,910	F1593L	probably benign	Het
Rims2	T	A	15: 39,292,208	C95S	probably damaging	Het
Stard9	A	G	2: 120,697,791	M1510V	probably benign	Het
Taf12	A	G	4: 132,282,995	I92V	probably benign	Het
Tma16	C	T	8: 66,484,171		probably null	Het
Tssk5	G	A	15: 76,374,543	R48C	probably benign	Het
Wwtr1	T	C	3: 57,575,259		probably null	Het
Zfp286	C	G	11: 62,780,204	G348R	probably damaging	Het
Zfp473	T	A	7: 44,733,254	T552S	probably damaging	Het
Zzef1	T	C	11: 72,872,639	F1371L	probably benign	Het

Other mutations in Atp10a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00649:Atp10a	APN	7	58794482	missense	probably benign	0.06
IGL00973:Atp10a	APN	7	58807470	missense	probably damaging	1.00
IGL00984:Atp10a	APN	7	58658741	missense	probably damaging	1.00
IGL01086:Atp10a	APN	7	58824318	missense	probably damaging	0.96
IGL01296:Atp10a	APN	7	58813625	missense	probably benign	0.02
IGL01731:Atp10a	APN	7	58797562	missense	probably benign	0.16
IGL02081:Atp10a	APN	7	58827856	missense	possibly damaging	0.62
IGL02095:Atp10a	APN	7	58807393	missense	probably damaging	1.00
IGL02549:Atp10a	APN	7	58819733	missense	probably benign	0.00
IGL02558:Atp10a	APN	7	58819642	missense	probably damaging	0.98
IGL02659:Atp10a	APN	7	58813631	missense	probably benign
IGL02986:Atp10a	APN	7	58828721	missense	probably benign
IGL03218:Atp10a	APN	7	58788448	critical splice donor site	probably null
PIT4260001:Atp10a	UTSW	7	58791118	nonsense	probably null
PIT4445001:Atp10a	UTSW	7	58803467	missense	probably damaging	0.98
PIT4810001:Atp10a	UTSW	7	58813848	missense	probably damaging	0.99
R0091:Atp10a	UTSW	7	58774046	splice site	probably benign
R0349:Atp10a	UTSW	7	58803467	missense	probably damaging	0.98
R0426:Atp10a	UTSW	7	58784734	missense	probably benign	0.00
R0609:Atp10a	UTSW	7	58819740	splice site	probably null
R0722:Atp10a	UTSW	7	58816183	missense	possibly damaging	0.75
R0741:Atp10a	UTSW	7	58828589	missense	possibly damaging	0.90
R1172:Atp10a	UTSW	7	58803766	missense	probably benign	0.05
R1342:Atp10a	UTSW	7	58816146	splice site	probably benign
R1648:Atp10a	UTSW	7	58784827	missense	probably damaging	1.00
R1715:Atp10a	UTSW	7	58786505	missense	probably damaging	0.98
R1737:Atp10a	UTSW	7	58827238	splice site	probably benign
R1799:Atp10a	UTSW	7	58824434	missense	probably damaging	1.00
R1909:Atp10a	UTSW	7	58828712	missense	probably benign	0.12
R1918:Atp10a	UTSW	7	58827935	missense	possibly damaging	0.82
R2031:Atp10a	UTSW	7	58827930	nonsense	probably null
R2080:Atp10a	UTSW	7	58824327	missense	probably damaging	0.97
R2424:Atp10a	UTSW	7	58794555	missense	probably benign	0.16
R2696:Atp10a	UTSW	7	58813618	missense	probably benign	0.00
R3932:Atp10a	UTSW	7	58827104	missense	possibly damaging	0.69
R4198:Atp10a	UTSW	7	58813686	missense	probably damaging	1.00
R4632:Atp10a	UTSW	7	58807438	missense	possibly damaging	0.48
R4661:Atp10a	UTSW	7	58658500	small deletion	probably benign
R4782:Atp10a	UTSW	7	58791095	missense	probably benign
R4888:Atp10a	UTSW	7	58785307	missense	probably damaging	1.00
R4935:Atp10a	UTSW	7	58813764	missense	probably damaging	1.00
R5051:Atp10a	UTSW	7	58740246	frame shift	probably null
R5213:Atp10a	UTSW	7	58773983	missense	probably damaging	0.99
R5617:Atp10a	UTSW	7	58803675	missense	probably benign	0.06
R5834:Atp10a	UTSW	7	58658618	missense	probably benign	0.01
R5885:Atp10a	UTSW	7	58813800	missense	possibly damaging	0.92
R6013:Atp10a	UTSW	7	58797790	missense	probably benign	0.05
R6136:Atp10a	UTSW	7	58828340	missense	probably benign
R6269:Atp10a	UTSW	7	58803739	missense	possibly damaging	0.51
R6380:Atp10a	UTSW	7	58819684	nonsense	probably null
R6743:Atp10a	UTSW	7	58797814	missense	possibly damaging	0.89
R6875:Atp10a	UTSW	7	58797352	missense	probably benign	0.01
R6975:Atp10a	UTSW	7	58773985	missense	probably damaging	1.00
R7082:Atp10a	UTSW	7	58658819	missense	probably damaging	1.00
R7203:Atp10a	UTSW	7	58786473	missense	probably benign
R7224:Atp10a	UTSW	7	58797471	missense	probably benign	0.00
R7287:Atp10a	UTSW	7	58827269	missense	probably damaging	1.00
R7437:Atp10a	UTSW	7	58658540	missense	unknown
R7474:Atp10a	UTSW	7	58658527	missense	unknown
R7530:Atp10a	UTSW	7	58773976	missense	probably benign	0.02
R7561:Atp10a	UTSW	7	58827133	missense	probably damaging	0.98
R7743:Atp10a	UTSW	7	58803709	missense	probably damaging	1.00
R7767:Atp10a	UTSW	7	58658849	missense	probably damaging	1.00
R7861:Atp10a	UTSW	7	58788359	missense	probably damaging	1.00
R7903:Atp10a	UTSW	7	58658822	missense	probably damaging	1.00
R8015:Atp10a	UTSW	7	58803497	missense	probably benign	0.00
R8166:Atp10a	UTSW	7	58807522	missense	possibly damaging	0.46
R8201:Atp10a	UTSW	7	58819676	nonsense	probably null
R8465:Atp10a	UTSW	7	58828310	missense	probably benign	0.32
Z1176:Atp10a	UTSW	7	58788447	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GTAGACCTGGAAGTCTGGACAG -3'
(R):5'- ACAGCAGCGTGTACTTGGTG -3'

Sequencing Primer
(F):5'- TGGAAGTCTGGACAGGCTGC -3'
(R):5'- CAGCGTGTACTTGGTGGTCTTG -3'

Posted On

2015-07-21