Incidental Mutation 'R4453:Tma16'
ID329048
Institutional Source Beutler Lab
Gene Symbol Tma16
Ensembl Gene ENSMUSG00000025591
Gene Nametranslation machinery associated 16
Synonyms
MMRRC Submission 041152-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R4453 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location66473118-66486530 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) C to T at 66484171 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000026681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026681] [ENSMUST00000143972]
Predicted Effect probably null
Transcript: ENSMUST00000026681
SMART Domains Protein: ENSMUSP00000026681
Gene: ENSMUSG00000025591

DomainStartEndE-ValueType
Pfam:DUF2962 10 162 1.6e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143972
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213036
Meta Mutation Damage Score 0.9588 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano7 A G 1: 93,394,353 D361G probably damaging Het
Atp10a TGGCGGCGGC TGGCGGC 7: 58,658,500 probably benign Het
Ccdc86 G T 19: 10,948,519 P239T probably damaging Het
Ces2h G A 8: 105,014,656 probably null Het
Ckap5 T A 2: 91,548,845 S43R probably damaging Het
Cpne6 G A 14: 55,512,597 V62M probably damaging Het
Dmbt1 T C 7: 131,040,934 C161R probably damaging Het
Dnajc10 T C 2: 80,346,623 S641P probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Grm2 G A 9: 106,653,879 T137I probably damaging Het
Gusb A G 5: 129,998,483 V327A possibly damaging Het
Helz C T 11: 107,672,629 Q1631* probably null Het
Hspa1a A G 17: 34,970,293 Y545H probably benign Het
Hus1 A T 11: 9,006,035 M166K probably damaging Het
Kcnh1 C A 1: 192,505,517 T762K probably damaging Het
Limd1 C A 9: 123,480,294 Q353K possibly damaging Het
Lipe T A 7: 25,397,690 K276I probably damaging Het
Ntpcr G A 8: 125,736,190 V49I probably benign Het
Olfr814 T C 10: 129,874,661 N32S probably null Het
Ppp1r1c A G 2: 79,708,231 I20V possibly damaging Het
Prdm13 G T 4: 21,679,464 A342E unknown Het
Prkd3 C A 17: 78,983,546 R180L probably damaging Het
Prune2 T C 19: 17,121,910 F1593L probably benign Het
Rims2 T A 15: 39,292,208 C95S probably damaging Het
Stard9 A G 2: 120,697,791 M1510V probably benign Het
Taf12 A G 4: 132,282,995 I92V probably benign Het
Tssk5 G A 15: 76,374,543 R48C probably benign Het
Wwtr1 T C 3: 57,575,259 probably null Het
Zfp286 C G 11: 62,780,204 G348R probably damaging Het
Zfp473 T A 7: 44,733,254 T552S probably damaging Het
Zzef1 T C 11: 72,872,639 F1371L probably benign Het
Other mutations in Tma16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Tma16 APN 8 66480445 missense probably benign 0.00
IGL01321:Tma16 APN 8 66476860 missense probably benign 0.02
IGL02022:Tma16 APN 8 66486410 critical splice donor site probably null
R0064:Tma16 UTSW 8 66476805 missense possibly damaging 0.46
R3401:Tma16 UTSW 8 66484171 critical splice acceptor site probably null
R3402:Tma16 UTSW 8 66484171 critical splice acceptor site probably null
R3403:Tma16 UTSW 8 66484171 critical splice acceptor site probably null
R4399:Tma16 UTSW 8 66484171 critical splice acceptor site probably null
R4402:Tma16 UTSW 8 66484171 critical splice acceptor site probably null
R4421:Tma16 UTSW 8 66484171 critical splice acceptor site probably null
R4493:Tma16 UTSW 8 66484171 critical splice acceptor site probably null
R4856:Tma16 UTSW 8 66481477 missense probably damaging 1.00
R4886:Tma16 UTSW 8 66481477 missense probably damaging 1.00
R5527:Tma16 UTSW 8 66484124 missense possibly damaging 0.94
R6312:Tma16 UTSW 8 66481466 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGTAGATGCATAAAGGCGCTTTC -3'
(R):5'- AACTACTTTAAGCTGGCATGGC -3'

Sequencing Primer
(F):5'- ATAAAGGCGCTTTCCCCAGTG -3'
(R):5'- TAAGCTGGCATGGCTGAGTCAC -3'
Posted On2015-07-21