Incidental Mutation 'R4453:Ntpcr'
ID329050
Institutional Source Beutler Lab
Gene Symbol Ntpcr
Ensembl Gene ENSMUSG00000031851
Gene Namenucleoside-triphosphatase, cancer-related
Synonyms
MMRRC Submission 041152-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R4453 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location125729963-125748235 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 125736190 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 49 (V49I)
Ref Sequence ENSEMBL: ENSMUSP00000115996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034313] [ENSMUST00000065135] [ENSMUST00000143504] [ENSMUST00000152189]
Predicted Effect probably benign
Transcript: ENSMUST00000034313
AA Change: V53I

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000034313
Gene: ENSMUSG00000031851
AA Change: V53I

DomainStartEndE-ValueType
AAA 1 170 2.61e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065135
AA Change: V53I

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000069384
Gene: ENSMUSG00000031851
AA Change: V53I

DomainStartEndE-ValueType
Pfam:NTPase_1 4 107 1.4e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123554
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138656
Predicted Effect probably benign
Transcript: ENSMUST00000143504
AA Change: R48H

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000121271
Gene: ENSMUSG00000031851
AA Change: R48H

DomainStartEndE-ValueType
Pfam:NTPase_1 56 145 5.4e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151172
Predicted Effect probably benign
Transcript: ENSMUST00000152189
AA Change: V49I

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000115996
Gene: ENSMUSG00000031851
AA Change: V49I

DomainStartEndE-ValueType
Pfam:NTPase_1 6 178 3.2e-63 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a non-specific nucleoside triphosphatase that is slow-acting in vitro. This gene is overexpressed in many tumor tissues, and while it is not essential for the cell, overexpression is cytotoxic. However, the cytotoxicity is not related to its triphosphatase activity. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano7 A G 1: 93,394,353 D361G probably damaging Het
Atp10a TGGCGGCGGC TGGCGGC 7: 58,658,500 probably benign Het
Ccdc86 G T 19: 10,948,519 P239T probably damaging Het
Ces2h G A 8: 105,014,656 probably null Het
Ckap5 T A 2: 91,548,845 S43R probably damaging Het
Cpne6 G A 14: 55,512,597 V62M probably damaging Het
Dmbt1 T C 7: 131,040,934 C161R probably damaging Het
Dnajc10 T C 2: 80,346,623 S641P probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Grm2 G A 9: 106,653,879 T137I probably damaging Het
Gusb A G 5: 129,998,483 V327A possibly damaging Het
Helz C T 11: 107,672,629 Q1631* probably null Het
Hspa1a A G 17: 34,970,293 Y545H probably benign Het
Hus1 A T 11: 9,006,035 M166K probably damaging Het
Kcnh1 C A 1: 192,505,517 T762K probably damaging Het
Limd1 C A 9: 123,480,294 Q353K possibly damaging Het
Lipe T A 7: 25,397,690 K276I probably damaging Het
Olfr814 T C 10: 129,874,661 N32S probably null Het
Ppp1r1c A G 2: 79,708,231 I20V possibly damaging Het
Prdm13 G T 4: 21,679,464 A342E unknown Het
Prkd3 C A 17: 78,983,546 R180L probably damaging Het
Prune2 T C 19: 17,121,910 F1593L probably benign Het
Rims2 T A 15: 39,292,208 C95S probably damaging Het
Stard9 A G 2: 120,697,791 M1510V probably benign Het
Taf12 A G 4: 132,282,995 I92V probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tssk5 G A 15: 76,374,543 R48C probably benign Het
Wwtr1 T C 3: 57,575,259 probably null Het
Zfp286 C G 11: 62,780,204 G348R probably damaging Het
Zfp473 T A 7: 44,733,254 T552S probably damaging Het
Zzef1 T C 11: 72,872,639 F1371L probably benign Het
Other mutations in Ntpcr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Ntpcr APN 8 125747762 missense probably damaging 0.98
IGL01582:Ntpcr APN 8 125745242 missense probably benign 0.11
IGL01862:Ntpcr APN 8 125736098 missense probably benign 0.14
IGL02045:Ntpcr APN 8 125745452 splice site probably benign
IGL02077:Ntpcr APN 8 125737368 nonsense probably null
R0491:Ntpcr UTSW 8 125737354 nonsense probably null
R0988:Ntpcr UTSW 8 125737431 splice site probably benign
R1781:Ntpcr UTSW 8 125745402 missense probably damaging 1.00
R2412:Ntpcr UTSW 8 125745405 missense probably damaging 1.00
R3838:Ntpcr UTSW 8 125737372 missense probably damaging 1.00
R6126:Ntpcr UTSW 8 125735887 critical splice donor site probably null
R6440:Ntpcr UTSW 8 125745242 missense probably damaging 0.97
R6463:Ntpcr UTSW 8 125736104 missense probably benign 0.02
R7102:Ntpcr UTSW 8 125730055 missense unknown
R7910:Ntpcr UTSW 8 125747744 missense probably benign
R8230:Ntpcr UTSW 8 125737420 critical splice donor site probably null
X0024:Ntpcr UTSW 8 125745426 missense probably damaging 0.99
X0025:Ntpcr UTSW 8 125745315 missense probably damaging 1.00
Z1177:Ntpcr UTSW 8 125745284 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GACAAGGTAAAACTTCTTGACCC -3'
(R):5'- CTTGCCCATGACACTTCCAG -3'

Sequencing Primer
(F):5'- AAGGTAAAACTTCTTGACCCCTCTTC -3'
(R):5'- ACTCCTTGTCTCAGGGAAGAG -3'
Posted On2015-07-21