Mutagenetix > Incidental Mutations

Incidental Mutation 'R0044:Cpsf1'

32909

Institutional Source

Beutler Lab

Gene Symbol

Cpsf1

Ensembl Gene

ENSMUSG00000034022

Gene Name

cleavage and polyadenylation specific factor 1

Synonyms

MMRRC Submission

038338-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.971) question?

Stock #

R0044 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

76595803-76607591 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 76599553 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 830 (V830A)

Ref Sequence

ENSEMBL: ENSMUSP00000155308 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071898] [ENSMUST00000160784] [ENSMUST00000161612] [ENSMUST00000161732] [ENSMUST00000162503] [ENSMUST00000230157] [ENSMUST00000231042]

Predicted Effect

probably benign
Transcript: ENSMUST00000071898
AA Change: V830A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000071794
Gene: ENSMUSG00000034022
AA Change: V830A

Domain	Start	End	E-Value	Type
Pfam:MMS1_N	92	684	7.2e-42	PFAM
low complexity region	902	910	N/A	INTRINSIC
Pfam:CPSF_A	1071	1407	4.9e-94	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159049

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160094

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160410

Predicted Effect

probably benign
Transcript: ENSMUST00000160784

SMART Domains

Protein: ENSMUSP00000124666
Gene: ENSMUSG00000022550

Domain	Start	End	E-Value	Type
transmembrane domain	50	69	N/A	INTRINSIC
Pfam:ABC1	188	304	9.2e-38	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161311

Predicted Effect

probably benign
Transcript: ENSMUST00000161612

SMART Domains

Protein: ENSMUSP00000124701
Gene: ENSMUSG00000022550

Domain	Start	End	E-Value	Type
transmembrane domain	50	69	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161732

SMART Domains

Protein: ENSMUSP00000125482
Gene: ENSMUSG00000022550

Domain	Start	End	E-Value	Type
transmembrane domain	50	69	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161783

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162139

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162254

Predicted Effect

probably benign
Transcript: ENSMUST00000162503

SMART Domains

Protein: ENSMUSP00000125055
Gene: ENSMUSG00000022550

Domain	Start	End	E-Value	Type
transmembrane domain	50	69	N/A	INTRINSIC
Pfam:ABC1	188	304	2.3e-38	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229007

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229015

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229269

Predicted Effect

probably benign
Transcript: ENSMUST00000229287

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229367

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229437

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229447

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229504

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229797

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229798

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229982

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230149

Predicted Effect

probably benign
Transcript: ENSMUST00000230157
AA Change: V830A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230557

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230822

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230903

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231009

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231037

Predicted Effect

probably benign
Transcript: ENSMUST00000231042

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231191

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.6%

Validation Efficiency

100% (77/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cleavage and polyadenylation specificity factor (CPSF) is a multisubunit complex that plays a central role in 3-prime processing of pre-mRNAs. CPSF recognizes the AAUAAA signal in the pre-mRNA and interacts with other proteins to facilitate both RNA cleavage and poly(A) synthesis. CPSF1 is the largest subunit of the CPSF complex (Murthy and Manley, 1995 [PubMed 7590244]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430571L13Rik	A	C	9: 107,342,499	R50S	probably damaging	Het
Actn2	G	T	13: 12,275,127	T176N	possibly damaging	Het
Adamts7	T	C	9: 90,171,588	V62A	possibly damaging	Het
Adcy2	A	G	13: 68,727,899	S495P	possibly damaging	Het
Agbl3	A	T	6: 34,799,899	M447L	probably damaging	Het
Asxl1	C	T	2: 153,400,209	T893I	probably benign	Het
Atp11b	T	A	3: 35,812,252	I400N	probably damaging	Het
Bpifb2	C	T	2: 153,882,679		probably benign	Het
Capn1	T	A	19: 6,014,343	Y42F	probably benign	Het
Cdk5rap2	A	T	4: 70,360,901	L190H	probably damaging	Het
Cfap54	T	C	10: 93,035,433	I594V	probably null	Het
Cyp2c70	T	A	19: 40,165,371	N258I	possibly damaging	Het
Dctn1	T	G	6: 83,191,134	Y386D	probably damaging	Het
Degs2	T	C	12: 108,692,154	N189D	probably damaging	Het
Dido1	C	T	2: 180,661,819	A1431T	probably damaging	Het
Diras1	G	T	10: 81,022,138	S93*	probably null	Het
E130308A19Rik	T	A	4: 59,690,290	H41Q	possibly damaging	Het
Ebf2	C	T	14: 67,310,968		probably benign	Het
Fcho2	A	G	13: 98,755,544		probably benign	Het
Gbe1	T	A	16: 70,561,132	Y681*	probably null	Het
Gm10036	A	C	18: 15,832,816	K8T	probably benign	Het
Herc1	T	A	9: 66,448,175	M2236K	probably benign	Het
Hmcn2	A	T	2: 31,412,508	Y2948F	probably damaging	Het
Jakmip2	A	T	18: 43,582,105	C119S	probably benign	Het
Kif1b	A	G	4: 149,263,601		probably benign	Het
Kif6	T	C	17: 49,832,256		probably benign	Het
Lpin1	A	T	12: 16,568,529		probably benign	Het
Lrp2	T	C	2: 69,527,555	I377V	probably benign	Het
Mavs	C	A	2: 131,242,024	T147N	probably damaging	Het
Mcoln2	C	T	3: 146,183,561	T374M	probably damaging	Het
Mreg	T	G	1: 72,162,375	T153P	probably damaging	Het
Naglu	T	C	11: 101,071,217	I172T	probably damaging	Het
Ogdhl	T	C	14: 32,339,328	V492A	possibly damaging	Het
Olfr1245	A	G	2: 89,575,630	I32T	possibly damaging	Het
Parvg	A	G	15: 84,337,882	E323G	probably benign	Het
Pgap1	A	G	1: 54,493,368	L664S	probably damaging	Het
Pgm2l1	A	G	7: 100,250,332	N51S	probably benign	Het
Pik3r6	A	G	11: 68,544,750	T609A	probably benign	Het
Plcb4	T	A	2: 135,971,856	V705E	probably damaging	Het
Plppr5	T	A	3: 117,671,889		probably null	Het
Prkg2	C	A	5: 98,973,130	D411Y	probably damaging	Het
Ptprd	A	G	4: 76,086,329	V63A	probably benign	Het
Ptprz1	T	A	6: 23,007,403	I1655N	probably damaging	Het
Raf1	T	A	6: 115,623,515	D10V	probably benign	Het
Rexo1	T	A	10: 80,544,378	Q928L	probably benign	Het
Rpl7l1	A	C	17: 46,778,530		probably null	Het
Rrm2b	A	G	15: 37,953,688	S39P	possibly damaging	Het
Scn5a	A	G	9: 119,492,047		probably null	Het
Sgtb	A	G	13: 104,129,260	T93A	probably benign	Het
Sigirr	G	T	7: 141,092,313		probably null	Het
Slc16a7	T	C	10: 125,228,082	D462G	probably benign	Het
Slc25a30	C	T	14: 75,769,649	A85T	probably benign	Het
Spata24	A	G	18: 35,656,834	S167P	probably damaging	Het
Spock3	C	T	8: 63,144,007	T115I	possibly damaging	Het
Srgap2	A	G	1: 131,319,551	I581T	possibly damaging	Het
Syn2	A	T	6: 115,135,147	M23L	unknown	Het
Synrg	G	A	11: 84,009,181	V839I	probably damaging	Het
Tmtc1	A	G	6: 148,412,829		probably benign	Het
Tnfaip3	C	A	10: 19,011,626	M50I	probably damaging	Het
Topbp1	T	A	9: 103,325,773	I721N	possibly damaging	Het
Ttc22	T	G	4: 106,636,806	V321G	probably benign	Het
Ttc25	A	T	11: 100,567,001	I477F	probably damaging	Het
Ubr2	A	G	17: 46,992,985		probably benign	Het
Ubr4	T	C	4: 139,437,058		probably benign	Het
Usp24	T	C	4: 106,412,084		probably benign	Het
Vmn2r100	A	T	17: 19,522,179	I272L	possibly damaging	Het
Vrtn	T	A	12: 84,648,605	L43H	probably damaging	Het
Wnk1	G	T	6: 120,037,149	R162S	probably damaging	Het
Xkr9	G	A	1: 13,684,062	W93*	probably null	Het
Zfp804b	G	T	5: 6,769,655	P1136H	probably damaging	Het

Other mutations in Cpsf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Cpsf1	APN	15	76600216	missense	probably benign	0.27
IGL01013:Cpsf1	APN	15	76599297	nonsense	probably null
IGL01599:Cpsf1	APN	15	76596541	missense	probably damaging	1.00
IGL02008:Cpsf1	APN	15	76603091	missense	probably damaging	1.00
IGL02291:Cpsf1	APN	15	76602821	missense	probably damaging	1.00
IGL02901:Cpsf1	APN	15	76599496	nonsense	probably null
IGL02929:Cpsf1	APN	15	76602127	critical splice donor site	probably null
IGL03402:Cpsf1	APN	15	76596003	splice site	probably null
R0005:Cpsf1	UTSW	15	76600680	critical splice donor site	probably null
R0044:Cpsf1	UTSW	15	76599553	missense	probably benign
R0487:Cpsf1	UTSW	15	76597002	missense	probably damaging	1.00
R0510:Cpsf1	UTSW	15	76603657	intron	probably benign
R0630:Cpsf1	UTSW	15	76601971	missense	probably damaging	1.00
R0780:Cpsf1	UTSW	15	76600377	missense	probably benign	0.17
R1617:Cpsf1	UTSW	15	76602370	nonsense	probably null
R1717:Cpsf1	UTSW	15	76602566	missense	possibly damaging	0.77
R1889:Cpsf1	UTSW	15	76602156	missense	probably benign	0.06
R1994:Cpsf1	UTSW	15	76603160	missense	probably benign	0.03
R2168:Cpsf1	UTSW	15	76603737	missense	possibly damaging	0.69
R2359:Cpsf1	UTSW	15	76597673	missense	probably benign	0.02
R2697:Cpsf1	UTSW	15	76599329	missense	probably damaging	1.00
R2847:Cpsf1	UTSW	15	76602851	missense	probably damaging	1.00
R2848:Cpsf1	UTSW	15	76602851	missense	probably damaging	1.00
R3409:Cpsf1	UTSW	15	76601781	nonsense	probably null
R3410:Cpsf1	UTSW	15	76601781	nonsense	probably null
R3815:Cpsf1	UTSW	15	76601149	missense	probably benign	0.22
R4030:Cpsf1	UTSW	15	76601779	missense	possibly damaging	0.96
R4491:Cpsf1	UTSW	15	76597722	missense	possibly damaging	0.85
R4615:Cpsf1	UTSW	15	76596937	missense	possibly damaging	0.88
R5227:Cpsf1	UTSW	15	76598948	missense	probably damaging	1.00
R5353:Cpsf1	UTSW	15	76602571	missense	probably damaging	1.00
R5548:Cpsf1	UTSW	15	76597327	missense	possibly damaging	0.95
R5552:Cpsf1	UTSW	15	76599646	missense	probably benign	0.27
R5746:Cpsf1	UTSW	15	76599837	missense	probably benign	0.01
R6319:Cpsf1	UTSW	15	76596967	missense	probably damaging	1.00
R6360:Cpsf1	UTSW	15	76597455	frame shift	probably null
R6572:Cpsf1	UTSW	15	76597455	frame shift	probably null
R6574:Cpsf1	UTSW	15	76597455	frame shift	probably null
R6576:Cpsf1	UTSW	15	76597455	frame shift	probably null
R6577:Cpsf1	UTSW	15	76597455	frame shift	probably null
R6588:Cpsf1	UTSW	15	76596822	missense	probably damaging	1.00
R6595:Cpsf1	UTSW	15	76602510	missense	probably damaging	1.00
R6621:Cpsf1	UTSW	15	76603519	missense	probably damaging	1.00
R6880:Cpsf1	UTSW	15	76602539	missense	probably benign	0.06
R6954:Cpsf1	UTSW	15	76599496	missense	probably damaging	1.00
R7100:Cpsf1	UTSW	15	76596114	missense	possibly damaging	0.73
R7255:Cpsf1	UTSW	15	76597543	missense	probably damaging	1.00
R7318:Cpsf1	UTSW	15	76597275	nonsense	probably null
R7371:Cpsf1	UTSW	15	76600575	missense	probably damaging	1.00
R7387:Cpsf1	UTSW	15	76602566	missense	possibly damaging	0.77
R7446:Cpsf1	UTSW	15	76601750	missense	probably benign
R7612:Cpsf1	UTSW	15	76597009	missense	probably benign	0.00
R7739:Cpsf1	UTSW	15	76600311	missense	probably benign	0.00
R7878:Cpsf1	UTSW	15	76600500	missense	probably damaging	1.00
R7961:Cpsf1	UTSW	15	76600500	missense	probably damaging	1.00
X0052:Cpsf1	UTSW	15	76596302	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TAAGAAGGGTCTAGCCACTGGCAC -3'
(R):5'- ATGGAGGTAGGCACATTGCACG -3'

Sequencing Primer
(F):5'- GGCACCTTTTTGAAACGGAC -3'
(R):5'- CATTGCACGCTGCCGAC -3'

Posted On

2013-05-09