Incidental Mutation 'R4454:Tbc1d16'
ID329100
Institutional Source Beutler Lab
Gene Symbol Tbc1d16
Ensembl Gene ENSMUSG00000039976
Gene NameTBC1 domain family, member 16
Synonyms
MMRRC Submission 041714-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4454 (G1)
Quality Score115
Status Validated
Chromosome11
Chromosomal Location119143045-119228499 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 119157873 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 318 (T318M)
Ref Sequence ENSEMBL: ENSMUSP00000147182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036113] [ENSMUST00000207655]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036113
AA Change: T318M

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000048516
Gene: ENSMUSG00000039976
AA Change: T318M

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
Blast:TBC 63 362 5e-75 BLAST
Blast:TBC 373 418 2e-13 BLAST
TBC 421 659 4.39e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183965
Predicted Effect possibly damaging
Transcript: ENSMUST00000207655
AA Change: T318M

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,624,753 E163G probably damaging Het
AI481877 T C 4: 59,092,383 D266G possibly damaging Het
Ap4e1 T A 2: 127,047,141 F509I probably damaging Het
Asmt A T X: 170,672,721 M19L probably benign Het
Atf6 C T 1: 170,794,039 R471Q probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Baiap3 T A 17: 25,249,536 D250V probably damaging Het
C2cd4d T A 3: 94,363,747 F107I probably damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Cldn6 T C 17: 23,681,086 probably null Het
Cpa5 A G 6: 30,626,324 N228S possibly damaging Het
Crocc T C 4: 141,020,405 S1478G possibly damaging Het
Csmd1 A T 8: 15,945,011 C2675S probably damaging Het
Cthrc1 C A 15: 39,077,013 Q4K probably benign Het
Ddo A T 10: 40,647,547 I178F probably damaging Het
Dmxl1 A G 18: 49,893,332 T1836A probably benign Het
Dnah9 T G 11: 66,147,389 Q107P probably damaging Het
Dusp26 A G 8: 31,094,144 N93S probably damaging Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Epha5 T C 5: 84,156,444 I501V probably damaging Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fam227b T A 2: 126,146,268 probably benign Het
Fgd5 C T 6: 91,989,186 S642F probably damaging Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Gm12034 T A 11: 20,446,476 noncoding transcript Het
Gm13023 A G 4: 143,792,824 S52G probably benign Het
Liph T C 16: 21,984,268 D17G probably benign Het
Mbd3 A T 10: 80,393,983 L164H probably damaging Het
Med4 A G 14: 73,518,062 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nav2 A T 7: 49,548,544 probably null Het
Olfr728 T C 14: 50,140,496 I48V probably benign Het
Olfr904 C A 9: 38,464,642 F200L probably benign Het
Pcdha11 G A 18: 37,007,373 G685D probably benign Het
Pgc A G 17: 47,732,410 I228V probably benign Het
Rad51 C T 2: 119,131,568 H199Y probably damaging Het
Robo2 A T 16: 74,352,519 probably benign Het
Sap130 C T 18: 31,711,360 T861I probably damaging Het
Sh3tc2 A T 18: 62,007,773 D1061V probably damaging Het
Snapc3 A G 4: 83,418,759 E119G probably damaging Het
Sspo G A 6: 48,487,225 G3862D probably benign Het
Thrb T A 14: 18,011,187 W188R probably damaging Het
Thsd1 T C 8: 22,243,578 Y214H probably damaging Het
Tnfrsf13b T C 11: 61,141,438 V98A probably benign Het
Topbp1 T C 9: 103,344,871 Y1314H probably damaging Het
Ttn C A 2: 76,785,806 V8271L possibly damaging Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Utrn G T 10: 12,727,840 Q599K possibly damaging Het
Zfp995 G A 17: 21,879,951 T434I probably benign Het
Zfy1 G T Y: 725,518 T749K possibly damaging Het
Other mutations in Tbc1d16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01930:Tbc1d16 APN 11 119156075 missense possibly damaging 0.69
IGL01973:Tbc1d16 APN 11 119156707 missense probably benign 0.19
IGL02456:Tbc1d16 APN 11 119210546 missense probably damaging 1.00
H8441:Tbc1d16 UTSW 11 119149014 nonsense probably null
R0118:Tbc1d16 UTSW 11 119157816 missense probably damaging 1.00
R0255:Tbc1d16 UTSW 11 119147575 missense possibly damaging 0.94
R0330:Tbc1d16 UTSW 11 119158729 critical splice donor site probably null
R0620:Tbc1d16 UTSW 11 119209038 missense probably benign 0.04
R1502:Tbc1d16 UTSW 11 119154004 missense probably damaging 1.00
R1806:Tbc1d16 UTSW 11 119156101 missense probably damaging 1.00
R2163:Tbc1d16 UTSW 11 119155078 splice site probably benign
R2897:Tbc1d16 UTSW 11 119157828 missense probably damaging 0.97
R2898:Tbc1d16 UTSW 11 119157828 missense probably damaging 0.97
R5193:Tbc1d16 UTSW 11 119158820 missense probably benign 0.00
R5465:Tbc1d16 UTSW 11 119156059 missense probably benign
R5478:Tbc1d16 UTSW 11 119155091 missense probably benign 0.07
R5642:Tbc1d16 UTSW 11 119158791 missense probably damaging 0.98
R5721:Tbc1d16 UTSW 11 119158730 critical splice donor site probably null
R6195:Tbc1d16 UTSW 11 119210565 nonsense probably null
R6233:Tbc1d16 UTSW 11 119210565 nonsense probably null
R6596:Tbc1d16 UTSW 11 119157775 missense probably damaging 1.00
R6932:Tbc1d16 UTSW 11 119208916 missense probably damaging 1.00
R7023:Tbc1d16 UTSW 11 119158791 missense probably damaging 0.98
R7262:Tbc1d16 UTSW 11 119155095 missense probably benign 0.00
R8006:Tbc1d16 UTSW 11 119156072 missense probably damaging 0.96
R8506:Tbc1d16 UTSW 11 119148958 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGAGAGAGGAGCTTCCATCC -3'
(R):5'- AGCTGCTTGGCTTCCTAGGTAG -3'

Sequencing Primer
(F):5'- AGGAGCTTCCATCCCCTCG -3'
(R):5'- CTTCCTAGGTAGAGGGGGTAC -3'
Posted On2015-07-21