Incidental Mutation 'R4454:Med4'
ID 329104
Institutional Source Beutler Lab
Gene Symbol Med4
Ensembl Gene ENSMUSG00000022109
Gene Name mediator complex subunit 4
Synonyms p36 TRAP/SMCC/PC2 subunit, DRIP36, 2410046H15Rik, Vdrip, TRAP36, HSPC126, MED4
MMRRC Submission 041714-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock # R4454 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 73510025-73518849 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) A to G at 73518062 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000039537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022705] [ENSMUST00000043813]
AlphaFold Q9CQA5
Predicted Effect unknown
Transcript: ENSMUST00000022705
AA Change: D270G
SMART Domains Protein: ENSMUSP00000022705
Gene: ENSMUSG00000022109
AA Change: D270G

DomainStartEndE-ValueType
Pfam:Med4 63 206 7.8e-34 PFAM
low complexity region 259 270 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043813
SMART Domains Protein: ENSMUSP00000039537
Gene: ENSMUSG00000033405

DomainStartEndE-ValueType
Pfam:NUDIX 11 142 1.5e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228141
Meta Mutation Damage Score 0.1665 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the Mediator complex. The Mediator complex interacts with DNA-binding gene-specific transcription factors to modulate transcription by RNA polymerase II. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,624,753 E163G probably damaging Het
AI481877 T C 4: 59,092,383 D266G possibly damaging Het
Ap4e1 T A 2: 127,047,141 F509I probably damaging Het
Asmt A T X: 170,672,721 M19L probably benign Het
Atf6 C T 1: 170,794,039 R471Q probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Baiap3 T A 17: 25,249,536 D250V probably damaging Het
C2cd4d T A 3: 94,363,747 F107I probably damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Cldn6 T C 17: 23,681,086 probably null Het
Cpa5 A G 6: 30,626,324 N228S possibly damaging Het
Crocc T C 4: 141,020,405 S1478G possibly damaging Het
Csmd1 A T 8: 15,945,011 C2675S probably damaging Het
Cthrc1 C A 15: 39,077,013 Q4K probably benign Het
Ddo A T 10: 40,647,547 I178F probably damaging Het
Dmxl1 A G 18: 49,893,332 T1836A probably benign Het
Dnah9 T G 11: 66,147,389 Q107P probably damaging Het
Dusp26 A G 8: 31,094,144 N93S probably damaging Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Epha5 T C 5: 84,156,444 I501V probably damaging Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fam227b T A 2: 126,146,268 probably benign Het
Fgd5 C T 6: 91,989,186 S642F probably damaging Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Gm12034 T A 11: 20,446,476 noncoding transcript Het
Gm13023 A G 4: 143,792,824 S52G probably benign Het
Liph T C 16: 21,984,268 D17G probably benign Het
Mbd3 A T 10: 80,393,983 L164H probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nav2 A T 7: 49,548,544 probably null Het
Olfr728 T C 14: 50,140,496 I48V probably benign Het
Olfr904 C A 9: 38,464,642 F200L probably benign Het
Pcdha11 G A 18: 37,007,373 G685D probably benign Het
Pgc A G 17: 47,732,410 I228V probably benign Het
Rad51 C T 2: 119,131,568 H199Y probably damaging Het
Robo2 A T 16: 74,352,519 probably benign Het
Sap130 C T 18: 31,711,360 T861I probably damaging Het
Sh3tc2 A T 18: 62,007,773 D1061V probably damaging Het
Snapc3 A G 4: 83,418,759 E119G probably damaging Het
Sspo G A 6: 48,487,225 G3862D probably benign Het
Tbc1d16 G A 11: 119,157,873 T318M possibly damaging Het
Thrb T A 14: 18,011,187 W188R probably damaging Het
Thsd1 T C 8: 22,243,578 Y214H probably damaging Het
Tnfrsf13b T C 11: 61,141,438 V98A probably benign Het
Topbp1 T C 9: 103,344,871 Y1314H probably damaging Het
Ttn C A 2: 76,785,806 V8271L possibly damaging Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Utrn G T 10: 12,727,840 Q599K possibly damaging Het
Zfp995 G A 17: 21,879,951 T434I probably benign Het
Zfy1 G T Y: 725,518 T749K possibly damaging Het
Other mutations in Med4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Med4 APN 14 73517267 missense probably damaging 1.00
IGL02728:Med4 APN 14 73517975 missense possibly damaging 0.87
IGL02964:Med4 APN 14 73517921 missense probably damaging 0.98
R0718:Med4 UTSW 14 73516657 missense probably damaging 1.00
R2131:Med4 UTSW 14 73517996 missense possibly damaging 0.82
R2156:Med4 UTSW 14 73518032 unclassified probably benign
R2320:Med4 UTSW 14 73517933 missense possibly damaging 0.86
R5361:Med4 UTSW 14 73510113 nonsense probably null
R6419:Med4 UTSW 14 73513923 missense probably damaging 1.00
R8461:Med4 UTSW 14 73518028 missense unknown
R8724:Med4 UTSW 14 73513809 nonsense probably null
R9172:Med4 UTSW 14 73513925 missense probably benign 0.00
R9322:Med4 UTSW 14 73510161 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACTAATCCCATGTGCCTC -3'
(R):5'- TCTTCAGTCTCATGCCAGGG -3'

Sequencing Primer
(F):5'- GGACTAATCCCATGTGCCTCTTTTC -3'
(R):5'- TCATGCCAGGGCTGCTATGTAC -3'
Posted On 2015-07-21