Mutagenetix > Incidental Mutations

Incidental Mutation 'R4454:Robo2'

329105

Institutional Source

Beutler Lab

Gene Symbol

Robo2

Ensembl Gene

ENSMUSG00000052516

Gene Name

roundabout guidance receptor 2

Synonyms

9430089E08Rik, 2600013A04Rik, D230004I22Rik

MMRRC Submission

041714-MU

Accession Numbers

Ncbi RefSeq: NM_175549.4; MGI:1890110

Is this an essential gene?

Probably essential (E-score: 0.925) question?

Stock #

R4454 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

73891839-74411825 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to T at 74352519 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000154010 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000117200] [ENSMUST00000117785] [ENSMUST00000226478] [ENSMUST00000227347]

Predicted Effect

probably benign
Transcript: ENSMUST00000117200

SMART Domains

Protein: ENSMUSP00000113795
Gene: ENSMUSG00000052516

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IGc2	43	117	3.56e-9	SMART
IGc2	145	210	3.33e-9	SMART
IGc2	237	300	6.59e-13	SMART
IGc2	326	398	1.3e-11	SMART
IGc2	430	495	3.73e-12	SMART
FN3	522	604	1.42e-15	SMART
FN3	636	721	3.54e-2	SMART
FN3	736	823	6.15e-11	SMART
transmembrane domain	860	882	N/A	INTRINSIC
low complexity region	1040	1065	N/A	INTRINSIC
low complexity region	1072	1083	N/A	INTRINSIC
low complexity region	1191	1199	N/A	INTRINSIC
low complexity region	1210	1234	N/A	INTRINSIC
low complexity region	1318	1342	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000117785

SMART Domains

Protein: ENSMUSP00000112776
Gene: ENSMUSG00000052516

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IGc2	43	117	3.56e-9	SMART
IGc2	145	210	3.33e-9	SMART
IGc2	237	300	6.59e-13	SMART
IGc2	326	398	1.3e-11	SMART
IGc2	430	495	3.73e-12	SMART
FN3	522	604	1.42e-15	SMART
FN3	636	721	3.54e-2	SMART
FN3	736	823	6.15e-11	SMART
transmembrane domain	860	882	N/A	INTRINSIC
low complexity region	1072	1107	N/A	INTRINSIC
low complexity region	1114	1125	N/A	INTRINSIC
low complexity region	1233	1241	N/A	INTRINSIC
low complexity region	1252	1276	N/A	INTRINSIC
low complexity region	1351	1362	N/A	INTRINSIC
low complexity region	1451	1475	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140062

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156010

Predicted Effect

probably benign
Transcript: ENSMUST00000226478

Predicted Effect

probably benign
Transcript: ENSMUST00000227347

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

100% (51/51)

MGI Phenotype

Strain: 3759448; 3043127
Lethality: D1
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ROBO family, part of the immunoglobulin superfamily of proteins that are highly conserved from fly to human. The encoded protein is a transmembrane receptor for the slit homolog 2 protein and functions in axon guidance and cell migration. Mutations in this gene are associated with vesicoureteral reflux, characterized by the backward flow of urine from the bladder into the ureters or the kidney. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutants display postnatal lethality, abnormal ureteric bud development, multiple fused kidneys, multiple ureters, and abnormal commissural axon growth. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted(3) Gene trapped(3)

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	T	C	1: 37,624,753	E163G	probably damaging	Het
AI481877	T	C	4: 59,092,383	D266G	possibly damaging	Het
Ap4e1	T	A	2: 127,047,141	F509I	probably damaging	Het
Asmt	A	T	X: 170,672,721	M19L	probably benign	Het
Atf6	C	T	1: 170,794,039	R471Q	probably damaging	Het
Atp4a	G	A	7: 30,720,225	R671Q	probably benign	Het
Baiap3	T	A	17: 25,249,536	D250V	probably damaging	Het
C2cd4d	T	A	3: 94,363,747	F107I	probably damaging	Het
Cdkn2d	C	G	9: 21,290,889	V21L	probably benign	Het
Cldn6	T	C	17: 23,681,086		probably null	Het
Cpa5	A	G	6: 30,626,324	N228S	possibly damaging	Het
Crocc	T	C	4: 141,020,405	S1478G	possibly damaging	Het
Csmd1	A	T	8: 15,945,011	C2675S	probably damaging	Het
Cthrc1	C	A	15: 39,077,013	Q4K	probably benign	Het
Ddo	A	T	10: 40,647,547	I178F	probably damaging	Het
Dmxl1	A	G	18: 49,893,332	T1836A	probably benign	Het
Dnah9	T	G	11: 66,147,389	Q107P	probably damaging	Het
Dusp26	A	G	8: 31,094,144	N93S	probably damaging	Het
Egr2	GAA	GA	10: 67,539,903		probably null	Het
Epha5	T	C	5: 84,156,444	I501V	probably damaging	Het
Eya1	C	T	1: 14,183,196	V519M	probably damaging	Het
Fam227b	T	A	2: 126,146,268		probably benign	Het
Fgd5	C	T	6: 91,989,186	S642F	probably damaging	Het
Fsip2	G	T	2: 82,990,776	A5618S	possibly damaging	Het
Gm12034	T	A	11: 20,446,476		noncoding transcript	Het
Gm13023	A	G	4: 143,792,824	S52G	probably benign	Het
Liph	T	C	16: 21,984,268	D17G	probably benign	Het
Mbd3	A	T	10: 80,393,983	L164H	probably damaging	Het
Med4	A	G	14: 73,518,062		probably benign	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Nav2	A	T	7: 49,548,544		probably null	Het
Olfr728	T	C	14: 50,140,496	I48V	probably benign	Het
Olfr904	C	A	9: 38,464,642	F200L	probably benign	Het
Pcdha11	G	A	18: 37,007,373	G685D	probably benign	Het
Pgc	A	G	17: 47,732,410	I228V	probably benign	Het
Rad51	C	T	2: 119,131,568	H199Y	probably damaging	Het
Sap130	C	T	18: 31,711,360	T861I	probably damaging	Het
Sh3tc2	A	T	18: 62,007,773	D1061V	probably damaging	Het
Snapc3	A	G	4: 83,418,759	E119G	probably damaging	Het
Sspo	G	A	6: 48,487,225	G3862D	probably benign	Het
Tbc1d16	G	A	11: 119,157,873	T318M	possibly damaging	Het
Thrb	T	A	14: 18,011,187	W188R	probably damaging	Het
Thsd1	T	C	8: 22,243,578	Y214H	probably damaging	Het
Tnfrsf13b	T	C	11: 61,141,438	V98A	probably benign	Het
Topbp1	T	C	9: 103,344,871	Y1314H	probably damaging	Het
Ttn	C	A	2: 76,785,806	V8271L	possibly damaging	Het
Ttn	T	C	2: 76,946,913	M1382V	probably benign	Het
Utrn	G	T	10: 12,727,840	Q599K	possibly damaging	Het
Zfp995	G	A	17: 21,879,951	T434I	probably benign	Het
Zfy1	G	T	Y: 725,518	T749K	possibly damaging	Het

Other mutations in Robo2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00666:Robo2	APN	16	73961700	missense	probably benign
IGL00849:Robo2	APN	16	73973777	missense	possibly damaging	0.80
IGL00908:Robo2	APN	16	73985691	missense	probably damaging	0.98
IGL00944:Robo2	APN	16	73933697	missense	possibly damaging	0.92
IGL00955:Robo2	APN	16	74015972	missense	probably damaging	1.00
IGL00970:Robo2	APN	16	73897046	missense	probably benign	0.00
IGL01020:Robo2	APN	16	73928151	missense	probably benign	0.06
IGL01347:Robo2	APN	16	74352856	missense	probably damaging	1.00
IGL02280:Robo2	APN	16	74046816	missense	probably damaging	1.00
IGL02424:Robo2	APN	16	73973301	missense	possibly damaging	0.89
IGL03376:Robo2	APN	16	73956492	missense	probably damaging	1.00
LCD18:Robo2	UTSW	16	74055954	intron	probably benign
P0018:Robo2	UTSW	16	74046806	missense	possibly damaging	0.82
R0314:Robo2	UTSW	16	73956637	missense	probably damaging	1.00
R0324:Robo2	UTSW	16	73967851	missense	probably damaging	1.00
R0539:Robo2	UTSW	16	73985574	splice site	probably benign
R0620:Robo2	UTSW	16	73967802	missense	possibly damaging	0.92
R0630:Robo2	UTSW	16	73916205	missense	probably benign	0.05
R0701:Robo2	UTSW	16	74046874	missense	probably damaging	1.00
R1155:Robo2	UTSW	16	74035108	missense	probably damaging	1.00
R1168:Robo2	UTSW	16	73948296	missense	probably damaging	1.00
R1195:Robo2	UTSW	16	73916128	unclassified	probably null
R1195:Robo2	UTSW	16	73916128	unclassified	probably null
R1195:Robo2	UTSW	16	73916128	unclassified	probably null
R1317:Robo2	UTSW	16	74035024	missense	probably damaging	1.00
R1422:Robo2	UTSW	16	73978448	missense	probably damaging	0.99
R1452:Robo2	UTSW	16	73961910	missense	probably damaging	1.00
R1649:Robo2	UTSW	16	73899001	missense	probably benign	0.36
R1709:Robo2	UTSW	16	73956523	missense	possibly damaging	0.83
R1751:Robo2	UTSW	16	74035024	missense	probably damaging	1.00
R1761:Robo2	UTSW	16	74035024	missense	probably damaging	1.00
R1885:Robo2	UTSW	16	73916145	missense	probably benign	0.00
R1911:Robo2	UTSW	16	73958325	missense	probably damaging	1.00
R1919:Robo2	UTSW	16	73899154	missense	probably benign
R2005:Robo2	UTSW	16	73933115	missense	possibly damaging	0.82
R2851:Robo2	UTSW	16	73961888	missense	probably damaging	1.00
R3732:Robo2	UTSW	16	73920747	missense	possibly damaging	0.64
R3732:Robo2	UTSW	16	73920747	missense	possibly damaging	0.64
R3733:Robo2	UTSW	16	73920747	missense	possibly damaging	0.64
R3734:Robo2	UTSW	16	73920747	missense	possibly damaging	0.64
R3913:Robo2	UTSW	16	74035005	missense	probably damaging	1.00
R3956:Robo2	UTSW	16	73961867	missense	probably damaging	1.00
R4394:Robo2	UTSW	16	73948379	missense	probably benign	0.13
R4426:Robo2	UTSW	16	73948266	missense	probably damaging	1.00
R4437:Robo2	UTSW	16	73973244	missense	possibly damaging	0.88
R4478:Robo2	UTSW	16	74015873	missense	probably damaging	1.00
R4586:Robo2	UTSW	16	73961873	missense	probably damaging	0.96
R4621:Robo2	UTSW	16	73985933	missense	probably benign	0.00
R4673:Robo2	UTSW	16	73904378	splice site	probably null
R4798:Robo2	UTSW	16	74352745	missense	probably damaging	1.00
R4812:Robo2	UTSW	16	73916288	missense	probably benign	0.00
R4855:Robo2	UTSW	16	73971191	missense	probably damaging	1.00
R4910:Robo2	UTSW	16	73933778	missense	probably damaging	0.99
R4916:Robo2	UTSW	16	73898915	missense	possibly damaging	0.53
R4948:Robo2	UTSW	16	74352838	missense	possibly damaging	0.88
R5325:Robo2	UTSW	16	73973785	missense	possibly damaging	0.72
R5326:Robo2	UTSW	16	73898965	missense	probably benign	0.20
R5447:Robo2	UTSW	16	73973766	nonsense	probably null
R5542:Robo2	UTSW	16	73898965	missense	probably benign	0.20
R5545:Robo2	UTSW	16	73961747	missense	probably damaging	1.00
R5646:Robo2	UTSW	16	73961819	missense	probably damaging	0.99
R5734:Robo2	UTSW	16	74352784	missense	probably damaging	1.00
R5892:Robo2	UTSW	16	73895780	utr 3 prime	probably benign
R5960:Robo2	UTSW	16	73933715	missense	probably damaging	1.00
R6126:Robo2	UTSW	16	73920682	missense	probably benign	0.00
R6130:Robo2	UTSW	16	73920682	missense	probably benign	0.00
R6153:Robo2	UTSW	16	73920729	missense	probably damaging	1.00
R6240:Robo2	UTSW	16	73982139	missense	probably damaging	1.00
R6247:Robo2	UTSW	16	73967784	missense	probably damaging	1.00
R6304:Robo2	UTSW	16	73958308	missense	probably damaging	1.00
R6337:Robo2	UTSW	16	73928151	missense	probably benign	0.06
R6431:Robo2	UTSW	16	74046809	nonsense	probably null
R6440:Robo2	UTSW	16	73916122	missense	probably benign	0.31
R6596:Robo2	UTSW	16	73971108	missense	probably damaging	1.00
R6919:Robo2	UTSW	16	73961867	missense	probably damaging	1.00
R6927:Robo2	UTSW	16	73982058	missense	probably damaging	1.00
R7029:Robo2	UTSW	16	73948337	missense	probably damaging	1.00
R7078:Robo2	UTSW	16	74352616	missense	probably damaging	1.00
R7092:Robo2	UTSW	16	73956643	missense	probably damaging	0.99
R7136:Robo2	UTSW	16	73956550	missense	probably damaging	0.99
R7192:Robo2	UTSW	16	73920750	missense	probably benign	0.19
R7569:Robo2	UTSW	16	74035115	missense	possibly damaging	0.82
R7686:Robo2	UTSW	16	73958405	missense	probably damaging	1.00
R7720:Robo2	UTSW	16	73897015	missense	probably benign	0.00
R7772:Robo2	UTSW	16	73961889	missense	probably benign	0.24
R7822:Robo2	UTSW	16	73973171	missense	probably damaging	1.00
X0063:Robo2	UTSW	16	74045828	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAATAGCATTATGTACTGCCCGTTAC -3'
(R):5'- TGATCCCAGGTCCCACAGAATG -3'

Sequencing Primer
(F):5'- CTGCCCGTTACTTAGATATAACAAC -3'
(R):5'- AGAATGCTTCTGCCCAGC -3'

Posted On

2015-07-21