Incidental Mutation 'R0044:Gbe1'
ID32911
Institutional Source Beutler Lab
Gene Symbol Gbe1
Ensembl Gene ENSMUSG00000022707
Gene Nameglucan (1,4-alpha-), branching enzyme 1
Synonyms2310045H19Rik, D16Ertd536e, 2810426P10Rik
MMRRC Submission 038338-MU
Accession Numbers

Ncbi RefSeq: NM_028803.3; MGI:1921435

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0044 (G1)
Quality Score99
Status Validated (trace)
Chromosome16
Chromosomal Location70313949-70569716 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 70561132 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 681 (Y681*)
Ref Sequence ENSEMBL: ENSMUSP00000131320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023393] [ENSMUST00000163832] [ENSMUST00000170464]
Predicted Effect probably null
Transcript: ENSMUST00000023393
AA Change: Y681*
SMART Domains Protein: ENSMUSP00000023393
Gene: ENSMUSG00000022707
AA Change: Y681*

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:CBM_48 75 161 9.4e-17 PFAM
Pfam:Alpha-amylase 218 336 1.1e-17 PFAM
Pfam:Alpha-amylase_C 603 698 1.3e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163832
AA Change: Y681*
SMART Domains Protein: ENSMUSP00000132603
Gene: ENSMUSG00000022707
AA Change: Y681*

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:CBM_48 75 161 6e-19 PFAM
Pfam:Alpha-amylase 220 337 5.9e-14 PFAM
Pfam:Alpha-amylase_C 603 698 2.2e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169432
Predicted Effect probably null
Transcript: ENSMUST00000170464
AA Change: Y681*
SMART Domains Protein: ENSMUSP00000131320
Gene: ENSMUSG00000022707
AA Change: Y681*

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:CBM_48 75 161 9.4e-17 PFAM
Pfam:Alpha-amylase 218 336 1.1e-17 PFAM
Pfam:Alpha-amylase_C 603 698 1.3e-24 PFAM
Meta Mutation Damage Score 0.9712 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 100% (77/77)
MGI Phenotype Strain: 4868492; 5293612
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycogen branching enzyme that catalyzes the transfer of alpha-1,4-linked glucosyl units from the outer end of a glycogen chain to an alpha-1,6 position on the same or a neighboring glycogen chain. Branching of the chains is essential to increase the solubility of the glycogen molecule and, consequently, in reducing the osmotic pressure within cells. Highest level of this enzyme are found in liver and muscle. Mutations in this gene are associated with glycogen storage disease IV (also known as Andersen's disease). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit mid-to-late gestation lethality, decreased heart rate, glycogen storage defects, and ventricles that were small, hypertrabeculated, and noncompacted. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Chemically induced(1)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430571L13Rik A C 9: 107,342,499 R50S probably damaging Het
Actn2 G T 13: 12,275,127 T176N possibly damaging Het
Adamts7 T C 9: 90,171,588 V62A possibly damaging Het
Adcy2 A G 13: 68,727,899 S495P possibly damaging Het
Agbl3 A T 6: 34,799,899 M447L probably damaging Het
Asxl1 C T 2: 153,400,209 T893I probably benign Het
Atp11b T A 3: 35,812,252 I400N probably damaging Het
Bpifb2 C T 2: 153,882,679 probably benign Het
Capn1 T A 19: 6,014,343 Y42F probably benign Het
Cdk5rap2 A T 4: 70,360,901 L190H probably damaging Het
Cfap54 T C 10: 93,035,433 I594V probably null Het
Cpsf1 A G 15: 76,599,553 V830A probably benign Het
Cyp2c70 T A 19: 40,165,371 N258I possibly damaging Het
Dctn1 T G 6: 83,191,134 Y386D probably damaging Het
Degs2 T C 12: 108,692,154 N189D probably damaging Het
Dido1 C T 2: 180,661,819 A1431T probably damaging Het
Diras1 G T 10: 81,022,138 S93* probably null Het
E130308A19Rik T A 4: 59,690,290 H41Q possibly damaging Het
Ebf2 C T 14: 67,310,968 probably benign Het
Fcho2 A G 13: 98,755,544 probably benign Het
Gm10036 A C 18: 15,832,816 K8T probably benign Het
Herc1 T A 9: 66,448,175 M2236K probably benign Het
Hmcn2 A T 2: 31,412,508 Y2948F probably damaging Het
Jakmip2 A T 18: 43,582,105 C119S probably benign Het
Kif1b A G 4: 149,263,601 probably benign Het
Kif6 T C 17: 49,832,256 probably benign Het
Lpin1 A T 12: 16,568,529 probably benign Het
Lrp2 T C 2: 69,527,555 I377V probably benign Het
Mavs C A 2: 131,242,024 T147N probably damaging Het
Mcoln2 C T 3: 146,183,561 T374M probably damaging Het
Mreg T G 1: 72,162,375 T153P probably damaging Het
Naglu T C 11: 101,071,217 I172T probably damaging Het
Ogdhl T C 14: 32,339,328 V492A possibly damaging Het
Olfr1245 A G 2: 89,575,630 I32T possibly damaging Het
Parvg A G 15: 84,337,882 E323G probably benign Het
Pgap1 A G 1: 54,493,368 L664S probably damaging Het
Pgm2l1 A G 7: 100,250,332 N51S probably benign Het
Pik3r6 A G 11: 68,544,750 T609A probably benign Het
Plcb4 T A 2: 135,971,856 V705E probably damaging Het
Plppr5 T A 3: 117,671,889 probably null Het
Prkg2 C A 5: 98,973,130 D411Y probably damaging Het
Ptprd A G 4: 76,086,329 V63A probably benign Het
Ptprz1 T A 6: 23,007,403 I1655N probably damaging Het
Raf1 T A 6: 115,623,515 D10V probably benign Het
Rexo1 T A 10: 80,544,378 Q928L probably benign Het
Rpl7l1 A C 17: 46,778,530 probably null Het
Rrm2b A G 15: 37,953,688 S39P possibly damaging Het
Scn5a A G 9: 119,492,047 probably null Het
Sgtb A G 13: 104,129,260 T93A probably benign Het
Sigirr G T 7: 141,092,313 probably null Het
Slc16a7 T C 10: 125,228,082 D462G probably benign Het
Slc25a30 C T 14: 75,769,649 A85T probably benign Het
Spata24 A G 18: 35,656,834 S167P probably damaging Het
Spock3 C T 8: 63,144,007 T115I possibly damaging Het
Srgap2 A G 1: 131,319,551 I581T possibly damaging Het
Syn2 A T 6: 115,135,147 M23L unknown Het
Synrg G A 11: 84,009,181 V839I probably damaging Het
Tmtc1 A G 6: 148,412,829 probably benign Het
Tnfaip3 C A 10: 19,011,626 M50I probably damaging Het
Topbp1 T A 9: 103,325,773 I721N possibly damaging Het
Ttc22 T G 4: 106,636,806 V321G probably benign Het
Ttc25 A T 11: 100,567,001 I477F probably damaging Het
Ubr2 A G 17: 46,992,985 probably benign Het
Ubr4 T C 4: 139,437,058 probably benign Het
Usp24 T C 4: 106,412,084 probably benign Het
Vmn2r100 A T 17: 19,522,179 I272L possibly damaging Het
Vrtn T A 12: 84,648,605 L43H probably damaging Het
Wnk1 G T 6: 120,037,149 R162S probably damaging Het
Xkr9 G A 1: 13,684,062 W93* probably null Het
Zfp804b G T 5: 6,769,655 P1136H probably damaging Het
Other mutations in Gbe1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Gbe1 APN 16 70478369 missense probably damaging 1.00
IGL01783:Gbe1 APN 16 70401855 critical splice donor site probably null
IGL02437:Gbe1 APN 16 70434658 splice site probably benign
IGL02635:Gbe1 APN 16 70569014 missense probably damaging 1.00
IGL02836:Gbe1 APN 16 70561095 missense possibly damaging 0.90
IGL03331:Gbe1 APN 16 70433578 missense probably damaging 1.00
IGL03138:Gbe1 UTSW 16 70529063 utr 3 prime probably benign
PIT4515001:Gbe1 UTSW 16 70441116 nonsense probably null
R0044:Gbe1 UTSW 16 70561132 nonsense probably null
R0131:Gbe1 UTSW 16 70360852 splice site probably benign
R0178:Gbe1 UTSW 16 70478386 missense probably damaging 1.00
R0374:Gbe1 UTSW 16 70483914 missense probably benign 0.09
R1036:Gbe1 UTSW 16 70528887 missense probably damaging 1.00
R1162:Gbe1 UTSW 16 70381850 intron probably benign
R1759:Gbe1 UTSW 16 70488041 missense probably benign 0.11
R1780:Gbe1 UTSW 16 70495324 nonsense probably null
R1998:Gbe1 UTSW 16 70569041 missense probably damaging 1.00
R2001:Gbe1 UTSW 16 70528926 missense probably damaging 1.00
R2002:Gbe1 UTSW 16 70528926 missense probably damaging 1.00
R2269:Gbe1 UTSW 16 70436952 missense probably damaging 1.00
R2353:Gbe1 UTSW 16 70437021 splice site probably null
R2434:Gbe1 UTSW 16 70441212 missense probably damaging 1.00
R4114:Gbe1 UTSW 16 70483827 missense possibly damaging 0.64
R4528:Gbe1 UTSW 16 70478337 missense probably benign
R4736:Gbe1 UTSW 16 70495253 missense probably damaging 1.00
R4859:Gbe1 UTSW 16 70478401 missense probably damaging 1.00
R5884:Gbe1 UTSW 16 70528875 splice site probably null
R6222:Gbe1 UTSW 16 70529012 critical splice donor site probably null
R6527:Gbe1 UTSW 16 70433672 critical splice donor site probably null
R6770:Gbe1 UTSW 16 70314265 missense possibly damaging 0.86
R6770:Gbe1 UTSW 16 70401838 missense probably damaging 1.00
R6941:Gbe1 UTSW 16 70433556 small deletion probably benign
R7193:Gbe1 UTSW 16 70495370 missense probably damaging 1.00
R7232:Gbe1 UTSW 16 70436940 missense possibly damaging 0.91
R7343:Gbe1 UTSW 16 70361015 missense probably benign 0.09
R7810:Gbe1 UTSW 16 70527197 missense possibly damaging 0.92
R7822:Gbe1 UTSW 16 70433612 missense probably damaging 0.98
R7876:Gbe1 UTSW 16 70441171 missense probably benign
R8319:Gbe1 UTSW 16 70488076 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CAGAGGATGGGTTGTTTCCAGAGC -3'
(R):5'- ACCCAGAGTCTCTCACCACAGTTTC -3'

Sequencing Primer
(F):5'- AGGCGCTAGATCTTGGAACTC -3'
(R):5'- ACCACAGTTTCCTGTTTTGC -3'
Posted On2013-05-09