Mutagenetix > Incidental Mutation

Incidental Mutation 'R0044:Gbe1'

32911

Institutional Source

Beutler Lab

Gene Symbol

Gbe1

Ensembl Gene

ENSMUSG00000022707

Gene Name

glucan (1,4-alpha-), branching enzyme 1

Synonyms

2310045H19Rik, D16Ertd536e, 2810426P10Rik

MMRRC Submission

038338-MU

Accession Numbers

Ncbi RefSeq: NM_028803.3; MGI:1921435

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0044 (G1)

Quality Score

Status

Validated (trace)

Chromosome

Chromosomal Location

70313949-70569716 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 70561132 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 681 (Y681*)

Ref Sequence

ENSEMBL: ENSMUSP00000131320 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023393] [ENSMUST00000163832] [ENSMUST00000170464]

AlphaFold

Q9D6Y9

Predicted Effect

probably null
Transcript: ENSMUST00000023393
AA Change: Y681*

SMART Domains

Protein: ENSMUSP00000023393
Gene: ENSMUSG00000022707
AA Change: Y681*

Domain	Start	End	E-Value	Type
low complexity region	2	9	N/A	INTRINSIC
Pfam:CBM_48	75	161	9.4e-17	PFAM
Pfam:Alpha-amylase	218	336	1.1e-17	PFAM
Pfam:Alpha-amylase_C	603	698	1.3e-24	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000163832
AA Change: Y681*

SMART Domains

Protein: ENSMUSP00000132603
Gene: ENSMUSG00000022707
AA Change: Y681*

Domain	Start	End	E-Value	Type
low complexity region	2	9	N/A	INTRINSIC
Pfam:CBM_48	75	161	6e-19	PFAM
Pfam:Alpha-amylase	220	337	5.9e-14	PFAM
Pfam:Alpha-amylase_C	603	698	2.2e-25	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169432

Predicted Effect

probably null
Transcript: ENSMUST00000170464
AA Change: Y681*

SMART Domains

Protein: ENSMUSP00000131320
Gene: ENSMUSG00000022707
AA Change: Y681*

Domain	Start	End	E-Value	Type
low complexity region	2	9	N/A	INTRINSIC
Pfam:CBM_48	75	161	9.4e-17	PFAM
Pfam:Alpha-amylase	218	336	1.1e-17	PFAM
Pfam:Alpha-amylase_C	603	698	1.3e-24	PFAM

Meta Mutation Damage Score

0.9712

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.6%

Validation Efficiency

100% (77/77)

MGI Phenotype

Strain: 4868492; 5293612
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycogen branching enzyme that catalyzes the transfer of alpha-1,4-linked glucosyl units from the outer end of a glycogen chain to an alpha-1,6 position on the same or a neighboring glycogen chain. Branching of the chains is essential to increase the solubility of the glycogen molecule and, consequently, in reducing the osmotic pressure within cells. Highest level of this enzyme are found in liver and muscle. Mutations in this gene are associated with glycogen storage disease IV (also known as Andersen's disease). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit mid-to-late gestation lethality, decreased heart rate, glycogen storage defects, and ventricles that were small, hypertrabeculated, and noncompacted. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(3) Chemically induced(1)

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430571L13Rik	A	C	9: 107,342,499	R50S	probably damaging	Het
Actn2	G	T	13: 12,275,127	T176N	possibly damaging	Het
Adamts7	T	C	9: 90,171,588	V62A	possibly damaging	Het
Adcy2	A	G	13: 68,727,899	S495P	possibly damaging	Het
Agbl3	A	T	6: 34,799,899	M447L	probably damaging	Het
Asxl1	C	T	2: 153,400,209	T893I	probably benign	Het
Atp11b	T	A	3: 35,812,252	I400N	probably damaging	Het
Bpifb2	C	T	2: 153,882,679		probably benign	Het
Capn1	T	A	19: 6,014,343	Y42F	probably benign	Het
Cdk5rap2	A	T	4: 70,360,901	L190H	probably damaging	Het
Cfap54	T	C	10: 93,035,433	I594V	probably null	Het
Cpsf1	A	G	15: 76,599,553	V830A	probably benign	Het
Cyp2c70	T	A	19: 40,165,371	N258I	possibly damaging	Het
Dctn1	T	G	6: 83,191,134	Y386D	probably damaging	Het
Degs2	T	C	12: 108,692,154	N189D	probably damaging	Het
Dido1	C	T	2: 180,661,819	A1431T	probably damaging	Het
Diras1	G	T	10: 81,022,138	S93*	probably null	Het
E130308A19Rik	T	A	4: 59,690,290	H41Q	possibly damaging	Het
Ebf2	C	T	14: 67,310,968		probably benign	Het
Fcho2	A	G	13: 98,755,544		probably benign	Het
Gm10036	A	C	18: 15,832,816	K8T	probably benign	Het
Herc1	T	A	9: 66,448,175	M2236K	probably benign	Het
Hmcn2	A	T	2: 31,412,508	Y2948F	probably damaging	Het
Jakmip2	A	T	18: 43,582,105	C119S	probably benign	Het
Kif1b	A	G	4: 149,263,601		probably benign	Het
Kif6	T	C	17: 49,832,256		probably benign	Het
Lpin1	A	T	12: 16,568,529		probably benign	Het
Lrp2	T	C	2: 69,527,555	I377V	probably benign	Het
Mavs	C	A	2: 131,242,024	T147N	probably damaging	Het
Mcoln2	C	T	3: 146,183,561	T374M	probably damaging	Het
Mreg	T	G	1: 72,162,375	T153P	probably damaging	Het
Naglu	T	C	11: 101,071,217	I172T	probably damaging	Het
Ogdhl	T	C	14: 32,339,328	V492A	possibly damaging	Het
Olfr1245	A	G	2: 89,575,630	I32T	possibly damaging	Het
Parvg	A	G	15: 84,337,882	E323G	probably benign	Het
Pgap1	A	G	1: 54,493,368	L664S	probably damaging	Het
Pgm2l1	A	G	7: 100,250,332	N51S	probably benign	Het
Pik3r6	A	G	11: 68,544,750	T609A	probably benign	Het
Plcb4	T	A	2: 135,971,856	V705E	probably damaging	Het
Plppr5	T	A	3: 117,671,889		probably null	Het
Prkg2	C	A	5: 98,973,130	D411Y	probably damaging	Het
Ptprd	A	G	4: 76,086,329	V63A	probably benign	Het
Ptprz1	T	A	6: 23,007,403	I1655N	probably damaging	Het
Raf1	T	A	6: 115,623,515	D10V	probably benign	Het
Rexo1	T	A	10: 80,544,378	Q928L	probably benign	Het
Rpl7l1	A	C	17: 46,778,530		probably null	Het
Rrm2b	A	G	15: 37,953,688	S39P	possibly damaging	Het
Scn5a	A	G	9: 119,492,047		probably null	Het
Sgtb	A	G	13: 104,129,260	T93A	probably benign	Het
Sigirr	G	T	7: 141,092,313		probably null	Het
Slc16a7	T	C	10: 125,228,082	D462G	probably benign	Het
Slc25a30	C	T	14: 75,769,649	A85T	probably benign	Het
Spata24	A	G	18: 35,656,834	S167P	probably damaging	Het
Spock3	C	T	8: 63,144,007	T115I	possibly damaging	Het
Srgap2	A	G	1: 131,319,551	I581T	possibly damaging	Het
Syn2	A	T	6: 115,135,147	M23L	unknown	Het
Synrg	G	A	11: 84,009,181	V839I	probably damaging	Het
Tmtc1	A	G	6: 148,412,829		probably benign	Het
Tnfaip3	C	A	10: 19,011,626	M50I	probably damaging	Het
Topbp1	T	A	9: 103,325,773	I721N	possibly damaging	Het
Ttc22	T	G	4: 106,636,806	V321G	probably benign	Het
Ttc25	A	T	11: 100,567,001	I477F	probably damaging	Het
Ubr2	A	G	17: 46,992,985		probably benign	Het
Ubr4	T	C	4: 139,437,058		probably benign	Het
Usp24	T	C	4: 106,412,084		probably benign	Het
Vmn2r100	A	T	17: 19,522,179	I272L	possibly damaging	Het
Vrtn	T	A	12: 84,648,605	L43H	probably damaging	Het
Wnk1	G	T	6: 120,037,149	R162S	probably damaging	Het
Xkr9	G	A	1: 13,684,062	W93*	probably null	Het
Zfp804b	G	T	5: 6,769,655	P1136H	probably damaging	Het

Other mutations in Gbe1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01783:Gbe1	APN	16	70478369	missense	probably damaging	1.00
IGL01783:Gbe1	APN	16	70401855	critical splice donor site	probably null
IGL02437:Gbe1	APN	16	70434658	splice site	probably benign
IGL02635:Gbe1	APN	16	70569014	missense	probably damaging	1.00
IGL02836:Gbe1	APN	16	70561095	missense	possibly damaging	0.90
IGL03331:Gbe1	APN	16	70433578	missense	probably damaging	1.00
IGL03138:Gbe1	UTSW	16	70529063	utr 3 prime	probably benign
PIT4515001:Gbe1	UTSW	16	70441116	nonsense	probably null
R0044:Gbe1	UTSW	16	70561132	nonsense	probably null
R0131:Gbe1	UTSW	16	70360852	splice site	probably benign
R0178:Gbe1	UTSW	16	70478386	missense	probably damaging	1.00
R0374:Gbe1	UTSW	16	70483914	missense	probably benign	0.09
R1036:Gbe1	UTSW	16	70528887	missense	probably damaging	1.00
R1162:Gbe1	UTSW	16	70381850	intron	probably benign
R1759:Gbe1	UTSW	16	70488041	missense	probably benign	0.11
R1780:Gbe1	UTSW	16	70495324	nonsense	probably null
R1998:Gbe1	UTSW	16	70569041	missense	probably damaging	1.00
R2001:Gbe1	UTSW	16	70528926	missense	probably damaging	1.00
R2002:Gbe1	UTSW	16	70528926	missense	probably damaging	1.00
R2269:Gbe1	UTSW	16	70436952	missense	probably damaging	1.00
R2353:Gbe1	UTSW	16	70437021	splice site	probably null
R2434:Gbe1	UTSW	16	70441212	missense	probably damaging	1.00
R4114:Gbe1	UTSW	16	70483827	missense	possibly damaging	0.64
R4528:Gbe1	UTSW	16	70478337	missense	probably benign
R4736:Gbe1	UTSW	16	70495253	missense	probably damaging	1.00
R4859:Gbe1	UTSW	16	70478401	missense	probably damaging	1.00
R5884:Gbe1	UTSW	16	70528875	splice site	probably null
R6222:Gbe1	UTSW	16	70529012	critical splice donor site	probably null
R6527:Gbe1	UTSW	16	70433672	critical splice donor site	probably null
R6770:Gbe1	UTSW	16	70314265	missense	possibly damaging	0.86
R6770:Gbe1	UTSW	16	70401838	missense	probably damaging	1.00
R6941:Gbe1	UTSW	16	70433556	small deletion	probably benign
R7193:Gbe1	UTSW	16	70495370	missense	probably damaging	1.00
R7232:Gbe1	UTSW	16	70436940	missense	possibly damaging	0.91
R7343:Gbe1	UTSW	16	70361015	missense	probably benign	0.09
R7810:Gbe1	UTSW	16	70527197	missense	possibly damaging	0.92
R7822:Gbe1	UTSW	16	70433612	missense	probably damaging	0.98
R7876:Gbe1	UTSW	16	70441171	missense	probably benign
R8319:Gbe1	UTSW	16	70488076	missense	probably benign	0.05
R8487:Gbe1	UTSW	16	70436988	missense	probably damaging	1.00
R8958:Gbe1	UTSW	16	70478322	missense	probably damaging	1.00
R9058:Gbe1	UTSW	16	70527171	missense	possibly damaging	0.82
R9231:Gbe1	UTSW	16	70488101	missense	possibly damaging	0.96
R9358:Gbe1	UTSW	16	70441239	missense	probably benign	0.00
R9429:Gbe1	UTSW	16	70495315	missense	probably benign	0.01
R9562:Gbe1	UTSW	16	70401776	missense	probably benign	0.00
R9565:Gbe1	UTSW	16	70401776	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CAGAGGATGGGTTGTTTCCAGAGC -3'
(R):5'- ACCCAGAGTCTCTCACCACAGTTTC -3'

Sequencing Primer
(F):5'- AGGCGCTAGATCTTGGAACTC -3'
(R):5'- ACCACAGTTTCCTGTTTTGC -3'

Posted On

2013-05-09