Mutagenetix > Incidental Mutation

Incidental Mutation 'R4454:Pgc'

329110

Institutional Source

Beutler Lab

Gene Symbol

Pgc

Ensembl Gene

ENSMUSG00000023987

Gene Name

progastricsin (pepsinogen C)

Synonyms

Upg-1, 2210410L06Rik, Upg1

MMRRC Submission

041714-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.054) question?

Stock #

R4454 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

48037767-48045403 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 48043335 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 228 (I228V)

Ref Sequence

ENSEMBL: ENSMUSP00000024782 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024782] [ENSMUST00000086932] [ENSMUST00000144955]

AlphaFold

Q9D7R7

Predicted Effect

probably benign
Transcript: ENSMUST00000024782
AA Change: I228V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000024782
Gene: ENSMUSG00000023987
AA Change: I228V

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Pfam:A1_Propeptide	18	46	2.1e-17	PFAM
Pfam:Asp	75	391	6.3e-118	PFAM
Pfam:TAXi_N	76	232	7.2e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000086932

SMART Domains

Protein: ENSMUSP00000084151
Gene: ENSMUSG00000023990

Domain	Start	End	E-Value	Type
low complexity region	7	43	N/A	INTRINSIC
low complexity region	108	122	N/A	INTRINSIC
HLH	240	293	1.44e-15	SMART
Pfam:DUF3371	320	473	7e-41	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000144955

SMART Domains

Protein: ENSMUSP00000123459
Gene: ENSMUSG00000023987

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Pfam:A1_Propeptide	18	46	1.5e-18	PFAM
Pfam:Asp	63	143	1.4e-19	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an aspartic proteinase that belongs to the peptidase family A1. The encoded protein is a digestive enzyme that is produced in the stomach and constitutes a major component of the gastric mucosa. This protein is also secreted into the serum. This protein is synthesized as an inactive zymogen that includes a highly basic prosegment. This enzyme is converted into its active mature form at low pH by sequential cleavage of the prosegment that is carried out by the enzyme itself. Polymorphisms in this gene are associated with susceptibility to gastric cancers. Serum levels of this enzyme are used as a biomarker for certain gastric diseases including Helicobacter pylori related gastritis. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 1. [provided by RefSeq, Oct 2009]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ap4e1	T	A	2: 126,889,061 (GRCm39)	F509I	probably damaging	Het
Asmt	A	T	X: 169,106,456 (GRCm39)	M19L	probably benign	Het
Atf6	C	T	1: 170,621,608 (GRCm39)	R471Q	probably damaging	Het
Atp4a	G	A	7: 30,419,650 (GRCm39)	R671Q	probably benign	Het
Baiap3	T	A	17: 25,468,510 (GRCm39)	D250V	probably damaging	Het
C2cd4d	T	A	3: 94,271,054 (GRCm39)	F107I	probably damaging	Het
Cdkn2d	C	G	9: 21,202,185 (GRCm39)	V21L	probably benign	Het
Cldn6	T	C	17: 23,900,060 (GRCm39)		probably null	Het
Cpa5	A	G	6: 30,626,323 (GRCm39)	N228S	possibly damaging	Het
Cracdl	T	C	1: 37,663,834 (GRCm39)	E163G	probably damaging	Het
Crocc	T	C	4: 140,747,716 (GRCm39)	S1478G	possibly damaging	Het
Csmd1	A	T	8: 15,995,011 (GRCm39)	C2675S	probably damaging	Het
Cthrc1	C	A	15: 38,940,408 (GRCm39)	Q4K	probably benign	Het
Ddo	A	T	10: 40,523,543 (GRCm39)	I178F	probably damaging	Het
Dmxl1	A	G	18: 50,026,399 (GRCm39)	T1836A	probably benign	Het
Dnah9	T	G	11: 66,038,215 (GRCm39)	Q107P	probably damaging	Het
Dusp26	A	G	8: 31,584,172 (GRCm39)	N93S	probably damaging	Het
Egr2	GAA	GA	10: 67,375,733 (GRCm39)		probably null	Het
Epha5	T	C	5: 84,304,303 (GRCm39)	I501V	probably damaging	Het
Eya1	C	T	1: 14,253,420 (GRCm39)	V519M	probably damaging	Het
Fam227b	T	A	2: 125,988,188 (GRCm39)		probably benign	Het
Fgd5	C	T	6: 91,966,167 (GRCm39)	S642F	probably damaging	Het
Fsip2	G	T	2: 82,821,120 (GRCm39)	A5618S	possibly damaging	Het
Gm12034	T	A	11: 20,396,476 (GRCm39)		noncoding transcript	Het
Liph	T	C	16: 21,803,018 (GRCm39)	D17G	probably benign	Het
Mbd3	A	T	10: 80,229,817 (GRCm39)	L164H	probably damaging	Het
Med4	A	G	14: 73,755,502 (GRCm39)		probably benign	Het
Mslnl	G	A	17: 25,961,908 (GRCm39)	V128M	probably damaging	Het
Nav2	A	T	7: 49,198,292 (GRCm39)		probably null	Het
Or4k1	T	C	14: 50,377,953 (GRCm39)	I48V	probably benign	Het
Or8b1b	C	A	9: 38,375,938 (GRCm39)	F200L	probably benign	Het
Pcdha11	G	A	18: 37,140,426 (GRCm39)	G685D	probably benign	Het
Pramel25	A	G	4: 143,519,394 (GRCm39)	S52G	probably benign	Het
Rad51	C	T	2: 118,962,049 (GRCm39)	H199Y	probably damaging	Het
Robo2	A	T	16: 74,149,407 (GRCm39)		probably benign	Het
Sap130	C	T	18: 31,844,413 (GRCm39)	T861I	probably damaging	Het
Sh3tc2	A	T	18: 62,140,844 (GRCm39)	D1061V	probably damaging	Het
Shoc1	T	C	4: 59,092,383 (GRCm39)	D266G	possibly damaging	Het
Snapc3	A	G	4: 83,336,996 (GRCm39)	E119G	probably damaging	Het
Sspo	G	A	6: 48,464,159 (GRCm39)	G3862D	probably benign	Het
Tbc1d16	G	A	11: 119,048,699 (GRCm39)	T318M	possibly damaging	Het
Thrb	T	A	14: 18,011,187 (GRCm38)	W188R	probably damaging	Het
Thsd1	T	C	8: 22,733,594 (GRCm39)	Y214H	probably damaging	Het
Tnfrsf13b	T	C	11: 61,032,264 (GRCm39)	V98A	probably benign	Het
Topbp1	T	C	9: 103,222,070 (GRCm39)	Y1314H	probably damaging	Het
Ttn	C	A	2: 76,616,150 (GRCm39)	V8271L	possibly damaging	Het
Ttn	T	C	2: 76,777,257 (GRCm39)	M1382V	probably benign	Het
Utrn	G	T	10: 12,603,584 (GRCm39)	Q599K	possibly damaging	Het
Zfp995	G	A	17: 22,098,932 (GRCm39)	T434I	probably benign	Het
Zfy1	G	T	Y: 725,518 (GRCm39)	T749K	possibly damaging	Het

Other mutations in Pgc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01358:Pgc	APN	17	48,041,591 (GRCm39)	missense	probably benign	0.09
IGL01410:Pgc	APN	17	48,045,165 (GRCm39)	missense	probably damaging	0.98
IGL01647:Pgc	APN	17	48,043,329 (GRCm39)	missense	probably damaging	1.00
IGL02141:Pgc	APN	17	48,037,856 (GRCm39)	missense	probably damaging	1.00
IGL02719:Pgc	APN	17	48,039,792 (GRCm39)	missense	probably damaging	0.98
PIT4469001:Pgc	UTSW	17	48,039,680 (GRCm39)	nonsense	probably null
R0736:Pgc	UTSW	17	48,039,705 (GRCm39)	missense	probably damaging	1.00
R1118:Pgc	UTSW	17	48,039,828 (GRCm39)	critical splice donor site	probably null
R1669:Pgc	UTSW	17	48,044,715 (GRCm39)	missense	probably damaging	1.00
R2162:Pgc	UTSW	17	48,040,236 (GRCm39)	missense	probably null	0.96
R3831:Pgc	UTSW	17	48,040,236 (GRCm39)	missense	probably null	0.96
R3833:Pgc	UTSW	17	48,040,236 (GRCm39)	missense	probably null	0.96
R4908:Pgc	UTSW	17	48,039,819 (GRCm39)	missense	probably damaging	0.96
R5544:Pgc	UTSW	17	48,043,429 (GRCm39)	missense	probably benign	0.00
R6829:Pgc	UTSW	17	48,043,706 (GRCm39)	splice site	probably null
R7042:Pgc	UTSW	17	48,044,745 (GRCm39)	missense	probably benign	0.00
R7508:Pgc	UTSW	17	48,045,111 (GRCm39)	missense	probably benign	0.00
R8022:Pgc	UTSW	17	48,039,701 (GRCm39)	missense	probably benign	0.00
R9028:Pgc	UTSW	17	48,043,983 (GRCm39)	missense	possibly damaging	0.51
R9074:Pgc	UTSW	17	48,043,351 (GRCm39)	missense	probably damaging	0.98
Z1176:Pgc	UTSW	17	48,039,793 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GGGCTCCAGTCTAAAGGAAAC -3'
(R):5'- ACCTATGACTTTGGAGGAGGG -3'

Sequencing Primer
(F):5'- GGAAACACAGACTGTCCTCAGG -3'
(R):5'- GGTCTCCCACCCACCCTC -3'

Posted On

2015-07-21