Incidental Mutation 'R4454:Pcdha11'
ID329112
Institutional Source Beutler Lab
Gene Symbol Pcdha11
Ensembl Gene ENSMUSG00000102206
Gene Nameprotocadherin alpha 11
SynonymsA830022B16Rik, Crnr7, Cnr7
MMRRC Submission 041714-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R4454 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37010712-37187657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37007373 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 685 (G685D)
Ref Sequence ENSEMBL: ENSMUSP00000111322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070797] [ENSMUST00000115657] [ENSMUST00000115658] [ENSMUST00000115659] [ENSMUST00000115661] [ENSMUST00000115662] [ENSMUST00000192168] [ENSMUST00000192295] [ENSMUST00000192447] [ENSMUST00000192503] [ENSMUST00000192512] [ENSMUST00000192631] [ENSMUST00000193389] [ENSMUST00000193777] [ENSMUST00000193839] [ENSMUST00000194038] [ENSMUST00000194544] [ENSMUST00000194751] [ENSMUST00000195590]
Predicted Effect probably benign
Transcript: ENSMUST00000070797
SMART Domains Protein: ENSMUSP00000068828
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Pfam:Cadherin_tail 797 931 5.3e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097612
Predicted Effect probably benign
Transcript: ENSMUST00000115657
SMART Domains Protein: ENSMUSP00000111321
Gene: ENSMUSG00000102206

DomainStartEndE-ValueType
CA 21 131 2.95e-2 SMART
CA 155 240 7.44e-19 SMART
CA 264 347 5.63e-28 SMART
CA 371 452 3.14e-26 SMART
CA 476 562 1.42e-24 SMART
CA 593 675 1.03e-12 SMART
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
low complexity region 918 942 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115658
AA Change: G685D

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000111322
Gene: ENSMUSG00000007440
AA Change: G685D

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
CA 46 132 6.34e-2 SMART
CA 156 241 4.65e-20 SMART
CA 265 349 1.25e-25 SMART
CA 373 454 9.22e-24 SMART
CA 478 564 4.3e-24 SMART
CA 595 678 5.07e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 795 929 5.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115659
SMART Domains Protein: ENSMUSP00000111323
Gene: ENSMUSG00000103770

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
CA 75 161 2.46e-2 SMART
CA 185 270 8.1e-20 SMART
CA 294 378 1.69e-22 SMART
CA 402 483 1.52e-24 SMART
CA 507 593 5.68e-24 SMART
CA 624 705 6.69e-12 SMART
transmembrane domain 727 749 N/A INTRINSIC
Pfam:Cadherin_tail 828 962 5.6e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115662
SMART Domains Protein: ENSMUSP00000111326
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 916 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192168
SMART Domains Protein: ENSMUSP00000142293
Gene: ENSMUSG00000103092

DomainStartEndE-ValueType
CA 21 131 2.2e-2 SMART
CA 155 240 2.05e-21 SMART
CA 264 348 8.81e-21 SMART
CA 372 453 2.01e-24 SMART
CA 477 563 1.42e-24 SMART
CA 591 673 1.63e-15 SMART
transmembrane domain 693 715 N/A INTRINSIC
low complexity region 902 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192295
SMART Domains Protein: ENSMUSP00000142103
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 568 5.38e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192447
SMART Domains Protein: ENSMUSP00000142270
Gene: ENSMUSG00000102206

DomainStartEndE-ValueType
CA 21 131 1.5e-4 SMART
CA 155 240 3.6e-21 SMART
CA 264 347 2.8e-30 SMART
CA 371 452 1.5e-28 SMART
CA 476 562 6.8e-27 SMART
CA 593 675 4.9e-15 SMART
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192503
SMART Domains Protein: ENSMUSP00000141989
Gene: ENSMUSG00000102312

DomainStartEndE-ValueType
low complexity region 11 17 N/A INTRINSIC
CA 42 128 3.78e-2 SMART
CA 152 237 8.94e-22 SMART
CA 261 345 3.74e-24 SMART
CA 369 450 1.09e-25 SMART
CA 474 560 1.42e-24 SMART
CA 588 670 2.96e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 910 934 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192512
SMART Domains Protein: ENSMUSP00000141408
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
low complexity region 915 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192631
SMART Domains Protein: ENSMUSP00000142156
Gene: ENSMUSG00000104318

DomainStartEndE-ValueType
CA 21 131 2.58e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 1.42e-24 SMART
CA 372 453 9.36e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 671 4.03e-6 SMART
transmembrane domain 696 718 N/A INTRINSIC
low complexity region 905 929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193389
SMART Domains Protein: ENSMUSP00000141459
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193777
SMART Domains Protein: ENSMUSP00000141587
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
low complexity region 914 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193839
SMART Domains Protein: ENSMUSP00000142308
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193856
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194038
SMART Domains Protein: ENSMUSP00000142159
Gene: ENSMUSG00000103800

DomainStartEndE-ValueType
CA 20 131 6.34e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 2.04e-25 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 9.88e-24 SMART
CA 594 676 8.62e-15 SMART
transmembrane domain 699 721 N/A INTRINSIC
low complexity region 914 938 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194050
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194691
Predicted Effect probably benign
Transcript: ENSMUST00000194751
SMART Domains Protein: ENSMUSP00000142285
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
Pfam:Cadherin_2 29 112 4.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195590
SMART Domains Protein: ENSMUSP00000141355
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,624,753 E163G probably damaging Het
AI481877 T C 4: 59,092,383 D266G possibly damaging Het
Ap4e1 T A 2: 127,047,141 F509I probably damaging Het
Asmt A T X: 170,672,721 M19L probably benign Het
Atf6 C T 1: 170,794,039 R471Q probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Baiap3 T A 17: 25,249,536 D250V probably damaging Het
C2cd4d T A 3: 94,363,747 F107I probably damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Cldn6 T C 17: 23,681,086 probably null Het
Cpa5 A G 6: 30,626,324 N228S possibly damaging Het
Crocc T C 4: 141,020,405 S1478G possibly damaging Het
Csmd1 A T 8: 15,945,011 C2675S probably damaging Het
Cthrc1 C A 15: 39,077,013 Q4K probably benign Het
Ddo A T 10: 40,647,547 I178F probably damaging Het
Dmxl1 A G 18: 49,893,332 T1836A probably benign Het
Dnah9 T G 11: 66,147,389 Q107P probably damaging Het
Dusp26 A G 8: 31,094,144 N93S probably damaging Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Epha5 T C 5: 84,156,444 I501V probably damaging Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fam227b T A 2: 126,146,268 probably benign Het
Fgd5 C T 6: 91,989,186 S642F probably damaging Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Gm12034 T A 11: 20,446,476 noncoding transcript Het
Gm13023 A G 4: 143,792,824 S52G probably benign Het
Liph T C 16: 21,984,268 D17G probably benign Het
Mbd3 A T 10: 80,393,983 L164H probably damaging Het
Med4 A G 14: 73,518,062 probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nav2 A T 7: 49,548,544 probably null Het
Olfr728 T C 14: 50,140,496 I48V probably benign Het
Olfr904 C A 9: 38,464,642 F200L probably benign Het
Pgc A G 17: 47,732,410 I228V probably benign Het
Rad51 C T 2: 119,131,568 H199Y probably damaging Het
Robo2 A T 16: 74,352,519 probably benign Het
Sap130 C T 18: 31,711,360 T861I probably damaging Het
Sh3tc2 A T 18: 62,007,773 D1061V probably damaging Het
Snapc3 A G 4: 83,418,759 E119G probably damaging Het
Sspo G A 6: 48,487,225 G3862D probably benign Het
Tbc1d16 G A 11: 119,157,873 T318M possibly damaging Het
Thrb T A 14: 18,011,187 W188R probably damaging Het
Thsd1 T C 8: 22,243,578 Y214H probably damaging Het
Tnfrsf13b T C 11: 61,141,438 V98A probably benign Het
Topbp1 T C 9: 103,344,871 Y1314H probably damaging Het
Ttn C A 2: 76,785,806 V8271L possibly damaging Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Utrn G T 10: 12,727,840 Q599K possibly damaging Het
Zfp995 G A 17: 21,879,951 T434I probably benign Het
Zfy1 G T Y: 725,518 T749K possibly damaging Het
Other mutations in Pcdha11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Pcdha11 APN 18 37185008 missense probably damaging 1.00
IGL01843:Pcdha11 APN 18 37012833 missense probably benign 0.28
R1165:Pcdha11 UTSW 18 37007704 intron probably benign
R2422:Pcdha11 UTSW 18 37007272 missense probably damaging 0.99
R2423:Pcdha11 UTSW 18 37007424 missense possibly damaging 0.89
R2508:Pcdha11 UTSW 18 37012854 missense possibly damaging 0.86
R3114:Pcdha11 UTSW 18 37011807 missense probably damaging 1.00
R4173:Pcdha11 UTSW 18 37012623 missense probably damaging 0.99
R4255:Pcdha11 UTSW 18 37012790 missense probably benign 0.23
R4369:Pcdha11 UTSW 18 37006743 missense possibly damaging 0.70
R4489:Pcdha11 UTSW 18 37006916 missense possibly damaging 0.78
R4626:Pcdha11 UTSW 18 37006998 missense probably damaging 1.00
R4751:Pcdha11 UTSW 18 37006944 missense probably damaging 1.00
R4801:Pcdha11 UTSW 18 37005465 missense probably damaging 1.00
R4802:Pcdha11 UTSW 18 37005465 missense probably damaging 1.00
R4857:Pcdha11 UTSW 18 37011452 missense probably benign 0.02
R4995:Pcdha11 UTSW 18 37011027 missense probably benign 0.24
R5042:Pcdha11 UTSW 18 37011596 missense probably damaging 1.00
R5480:Pcdha11 UTSW 18 37005882 missense probably benign 0.04
R5495:Pcdha11 UTSW 18 37011026 missense probably benign
R5523:Pcdha11 UTSW 18 37012386 missense probably damaging 1.00
R5584:Pcdha11 UTSW 18 37006765 missense probably damaging 1.00
R5682:Pcdha11 UTSW 18 37011449 missense probably damaging 1.00
R5834:Pcdha11 UTSW 18 37012623 missense probably damaging 0.99
R5842:Pcdha11 UTSW 18 37011284 missense possibly damaging 0.85
R5859:Pcdha11 UTSW 18 37007283 missense probably damaging 1.00
R6110:Pcdha11 UTSW 18 37011456 missense probably damaging 1.00
R6135:Pcdha11 UTSW 18 37005817 missense probably damaging 1.00
R6248:Pcdha11 UTSW 18 37005897 missense probably benign 0.26
R6416:Pcdha11 UTSW 18 37012169 unclassified probably null
R6450:Pcdha11 UTSW 18 37013162 missense probably damaging 1.00
R6594:Pcdha11 UTSW 18 37011182 missense probably benign 0.04
R6631:Pcdha11 UTSW 18 37005791 missense probably damaging 1.00
R6883:Pcdha11 UTSW 18 37011189 missense probably damaging 1.00
R7088:Pcdha11 UTSW 18 37005417 missense probably benign 0.00
R7129:Pcdha11 UTSW 18 37007238 missense probably benign 0.45
R7153:Pcdha11 UTSW 18 37011225 missense probably damaging 1.00
R7244:Pcdha11 UTSW 18 37011368 nonsense probably null
R7295:Pcdha11 UTSW 18 37006926 missense probably damaging 1.00
R7319:Pcdha11 UTSW 18 37013192 missense probably benign 0.10
R7352:Pcdha11 UTSW 18 37006845 missense probably damaging 1.00
R7516:Pcdha11 UTSW 18 37011618 missense probably damaging 1.00
R7519:Pcdha11 UTSW 18 37006266 nonsense probably null
R7660:Pcdha11 UTSW 18 37005851 missense probably benign 0.17
R7677:Pcdha11 UTSW 18 37011552 missense probably damaging 1.00
R7707:Pcdha11 UTSW 18 37011792 missense probably benign 0.00
R7775:Pcdha11 UTSW 18 37012680 missense possibly damaging 0.64
R7778:Pcdha11 UTSW 18 37012680 missense possibly damaging 0.64
R7780:Pcdha11 UTSW 18 37012796 missense probably damaging 0.97
RF017:Pcdha11 UTSW 18 37005524 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GTCATATGAGCTCCAGTTCAGAG -3'
(R):5'- ACATACCAGCATGGGTTTCC -3'

Sequencing Primer
(F):5'- TCCAGTTCAGAGCTGGCAGTG -3'
(R):5'- TTTCCCGGGTCCACAGGTG -3'
Posted On2015-07-21