Incidental Mutation 'R4455:H3f3a'
ID329118
Institutional Source Beutler Lab
Gene Symbol H3f3a
Ensembl Gene ENSMUSG00000060743
Gene NameH3 histone, family 3A
SynonymsH3.3A
MMRRC Submission 041715-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.453) question?
Stock #R4455 (G1)
Quality Score105
Status Not validated
Chromosome1
Chromosomal Location180800832-180813943 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 180803103 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 129 (R129S)
Ref Sequence ENSEMBL: ENSMUSP00000125104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081026] [ENSMUST00000159789] [ENSMUST00000161308] [ENSMUST00000162814]
Predicted Effect probably benign
Transcript: ENSMUST00000081026
AA Change: R128S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000079816
Gene: ENSMUSG00000060743
AA Change: R128S

DomainStartEndE-ValueType
H3 34 135 2.77e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159789
SMART Domains Protein: ENSMUSP00000125754
Gene: ENSMUSG00000060743

DomainStartEndE-ValueType
H3 34 119 8.9e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161308
AA Change: R129S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000124509
Gene: ENSMUSG00000060743
AA Change: R129S

DomainStartEndE-ValueType
H3 34 136 4.79e-74 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162814
AA Change: R129S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000125104
Gene: ENSMUSG00000060743
AA Change: R129S

DomainStartEndE-ValueType
H3 34 136 4.79e-74 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181811
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene contains introns and its mRNA is polyadenylated, unlike most histone genes. The protein encoded is a replication-independent member of the histone H3 family. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous mutants for a hypomorphic gene trap allele display partial neonatal lethality, reduced fertility, growth abnormalities and neuromuscular defects. Mice homozygous for a reporter allele exhibit reduced body size and male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,397,196 H166R possibly damaging Het
Aktip T C 8: 91,124,851 E248G probably benign Het
Ankk1 A G 9: 49,418,066 V336A probably benign Het
Aoc1 T A 6: 48,905,467 D92E probably damaging Het
Arfgef2 T C 2: 166,894,715 I1769T probably benign Het
Arfgef3 A T 10: 18,607,675 S1434T probably benign Het
Baz1a C A 12: 54,911,368 V1033L probably benign Het
Bbs12 T C 3: 37,320,312 V418A probably damaging Het
Cacnb4 A G 2: 52,465,653 V214A probably damaging Het
Camk2d T C 3: 126,780,403 V153A probably damaging Het
Ccdc18 C T 5: 108,161,529 S330L possibly damaging Het
Cdh11 T C 8: 102,647,823 D500G probably benign Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Clca4a G A 3: 144,957,259 P610S probably damaging Het
Dctn1 T C 6: 83,195,049 L807P probably damaging Het
Dopey2 T C 16: 93,766,215 L869P probably damaging Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fam227b T A 2: 126,146,268 probably benign Het
Fam26f A T 10: 34,126,535 I184N probably damaging Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Grb10 T G 11: 11,967,665 Q72P possibly damaging Het
Hfm1 T C 5: 106,886,508 probably null Het
Kansl1 T C 11: 104,424,358 T285A possibly damaging Het
Krtap16-1 A T 11: 99,985,733 C282S probably benign Het
Magi1 A G 6: 93,785,457 V89A probably damaging Het
Mllt1 A G 17: 56,919,965 Y71H probably damaging Het
Ms4a14 T A 19: 11,303,626 T523S possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Muc5b T C 7: 141,858,818 S1834P unknown Het
Necap1 C T 6: 122,887,369 S270F possibly damaging Het
Piwil2 T C 14: 70,390,565 M752V probably benign Het
Prune1 G A 3: 95,281,896 probably null Het
Ptpro A G 6: 137,393,659 E586G probably damaging Het
Rela T A 19: 5,647,262 I499K probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Scara5 T A 14: 65,762,747 D455E probably benign Het
Slc2a4 G A 11: 69,943,322 probably benign Het
Sntb2 G A 8: 106,991,607 probably null Het
Sspo C T 6: 48,465,516 R1982C probably damaging Het
Svs1 A T 6: 48,987,460 N134I possibly damaging Het
Tsen34 G A 7: 3,695,098 probably null Het
Ttc28 AC A 5: 111,224,058 probably null Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Utp18 G A 11: 93,885,447 R71C probably benign Het
Xrn1 T A 9: 95,973,645 probably benign Het
Yeats2 A G 16: 20,161,993 K187R possibly damaging Het
Other mutations in H3f3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2297:H3f3a UTSW 1 180803138 missense probably benign 0.00
R2298:H3f3a UTSW 1 180803138 missense probably benign 0.00
R2299:H3f3a UTSW 1 180803138 missense probably benign 0.00
R2300:H3f3a UTSW 1 180803138 missense probably benign 0.00
R2351:H3f3a UTSW 1 180810158 missense probably benign
R2895:H3f3a UTSW 1 180803138 missense probably benign 0.00
R4052:H3f3a UTSW 1 180803138 missense probably benign 0.00
R4208:H3f3a UTSW 1 180803138 missense probably benign 0.00
R5582:H3f3a UTSW 1 180810085 intron probably benign
R7870:H3f3a UTSW 1 180811925 start codon destroyed probably null 0.61
R7953:H3f3a UTSW 1 180811925 start codon destroyed probably null 0.61
Predicted Primers PCR Primer
(F):5'- ACGCCAATACCTGATTCTGTC -3'
(R):5'- CATCTTGACAGGTTTCTATGTGAGC -3'

Sequencing Primer
(F):5'- AATACCTGATTCTGTCCCCTATG -3'
(R):5'- GAGCGTTTGATAAATTCTTTAAAGGG -3'
Posted On2015-07-21