Incidental Mutation 'R4455:Cacnb4'
ID329119
Institutional Source Beutler Lab
Gene Symbol Cacnb4
Ensembl Gene ENSMUSG00000017412
Gene Namecalcium channel, voltage-dependent, beta 4 subunit
SynonymsCchb4, 3110038O15Rik
MMRRC Submission 041715-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R4455 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location52428320-52676831 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52465653 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 214 (V214A)
Ref Sequence ENSEMBL: ENSMUSP00000077438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078324] [ENSMUST00000102760] [ENSMUST00000102761] [ENSMUST00000178799]
PDB Structure
BETA4 SUBUNIT OF CA2+ CHANNEL [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000078324
AA Change: V214A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077438
Gene: ENSMUSG00000017412
AA Change: V214A

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 49 90 5.4e-27 PFAM
SH3 94 159 4.96e-2 SMART
low complexity region 172 189 N/A INTRINSIC
low complexity region 193 206 N/A INTRINSIC
GuKc 217 398 3.46e-37 SMART
low complexity region 465 481 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102760
AA Change: V181A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099821
Gene: ENSMUSG00000017412
AA Change: V181A

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 16 57 9.4e-28 PFAM
SH3 61 126 4.96e-2 SMART
low complexity region 139 156 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
GuKc 184 365 3.46e-37 SMART
low complexity region 432 448 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102761
AA Change: V168A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099822
Gene: ENSMUSG00000017412
AA Change: V168A

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 3 44 4.8e-27 PFAM
SH3 48 113 4.96e-2 SMART
low complexity region 126 143 N/A INTRINSIC
low complexity region 147 160 N/A INTRINSIC
GuKc 171 352 3.46e-37 SMART
low complexity region 419 435 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178799
AA Change: V214A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136811
Gene: ENSMUSG00000017412
AA Change: V214A

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 49 90 1.3e-24 PFAM
SH3 94 159 4.96e-2 SMART
low complexity region 172 189 N/A INTRINSIC
GuKc 217 398 3.46e-37 SMART
low complexity region 465 481 N/A INTRINSIC
Meta Mutation Damage Score 0.6603 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta subunit family of voltage-dependent calcium channel complex proteins. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. The protein encoded by this locus plays an important role in calcium channel function by modulating G protein inhibition, increasing peak calcium current, controlling the alpha-1 subunit membrane targeting and shifting the voltage dependence of activation and inactivation. Certain mutations in this gene have been associated with idiopathic generalized epilepsy (IGE), juvenile myoclonic epilepsy (JME), and episodic ataxia, type 5. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous mutants have lethargic behavior, unstable gait and seizures, with peripheral motor nerves showing reduced conduction velocity and prolonged distal latency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,397,196 H166R possibly damaging Het
Aktip T C 8: 91,124,851 E248G probably benign Het
Ankk1 A G 9: 49,418,066 V336A probably benign Het
Aoc1 T A 6: 48,905,467 D92E probably damaging Het
Arfgef2 T C 2: 166,894,715 I1769T probably benign Het
Arfgef3 A T 10: 18,607,675 S1434T probably benign Het
Baz1a C A 12: 54,911,368 V1033L probably benign Het
Bbs12 T C 3: 37,320,312 V418A probably damaging Het
Camk2d T C 3: 126,780,403 V153A probably damaging Het
Ccdc18 C T 5: 108,161,529 S330L possibly damaging Het
Cdh11 T C 8: 102,647,823 D500G probably benign Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Clca4a G A 3: 144,957,259 P610S probably damaging Het
Dctn1 T C 6: 83,195,049 L807P probably damaging Het
Dopey2 T C 16: 93,766,215 L869P probably damaging Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fam227b T A 2: 126,146,268 probably benign Het
Fam26f A T 10: 34,126,535 I184N probably damaging Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Grb10 T G 11: 11,967,665 Q72P possibly damaging Het
H3f3a G T 1: 180,803,103 R129S probably benign Het
Hfm1 T C 5: 106,886,508 probably null Het
Kansl1 T C 11: 104,424,358 T285A possibly damaging Het
Krtap16-1 A T 11: 99,985,733 C282S probably benign Het
Magi1 A G 6: 93,785,457 V89A probably damaging Het
Mllt1 A G 17: 56,919,965 Y71H probably damaging Het
Ms4a14 T A 19: 11,303,626 T523S possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Muc5b T C 7: 141,858,818 S1834P unknown Het
Necap1 C T 6: 122,887,369 S270F possibly damaging Het
Piwil2 T C 14: 70,390,565 M752V probably benign Het
Prune1 G A 3: 95,281,896 probably null Het
Ptpro A G 6: 137,393,659 E586G probably damaging Het
Rela T A 19: 5,647,262 I499K probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Scara5 T A 14: 65,762,747 D455E probably benign Het
Slc2a4 G A 11: 69,943,322 probably benign Het
Sntb2 G A 8: 106,991,607 probably null Het
Sspo C T 6: 48,465,516 R1982C probably damaging Het
Svs1 A T 6: 48,987,460 N134I possibly damaging Het
Tsen34 G A 7: 3,695,098 probably null Het
Ttc28 AC A 5: 111,224,058 probably null Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Utp18 G A 11: 93,885,447 R71C probably benign Het
Xrn1 T A 9: 95,973,645 probably benign Het
Yeats2 A G 16: 20,161,993 K187R possibly damaging Het
Other mutations in Cacnb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Cacnb4 APN 2 52477712 missense possibly damaging 0.46
IGL01328:Cacnb4 APN 2 52464625 missense probably damaging 1.00
IGL01801:Cacnb4 APN 2 52434711 missense probably benign 0.15
IGL01992:Cacnb4 APN 2 52465670 missense probably damaging 1.00
IGL03030:Cacnb4 APN 2 52474882 missense probably damaging 1.00
R0789:Cacnb4 UTSW 2 52451883 missense probably damaging 1.00
R1069:Cacnb4 UTSW 2 52455611 missense probably damaging 1.00
R1646:Cacnb4 UTSW 2 52474900 missense possibly damaging 0.87
R2050:Cacnb4 UTSW 2 52469586 missense probably damaging 0.99
R3939:Cacnb4 UTSW 2 52469489 missense probably damaging 1.00
R3941:Cacnb4 UTSW 2 52469489 missense probably damaging 1.00
R4497:Cacnb4 UTSW 2 52477771 missense probably damaging 1.00
R4707:Cacnb4 UTSW 2 52474915 missense probably benign 0.45
R4824:Cacnb4 UTSW 2 52675810 missense probably benign 0.00
R4957:Cacnb4 UTSW 2 52558291 missense probably damaging 0.99
R5913:Cacnb4 UTSW 2 52434784 intron probably benign
R6372:Cacnb4 UTSW 2 52434667 missense probably benign 0.00
R6945:Cacnb4 UTSW 2 52474954 missense probably damaging 1.00
R7557:Cacnb4 UTSW 2 52469567 missense probably damaging 1.00
R7821:Cacnb4 UTSW 2 52434508 missense possibly damaging 0.91
R8015:Cacnb4 UTSW 2 52464643 missense probably damaging 1.00
R8043:Cacnb4 UTSW 2 52465651 missense probably damaging 1.00
Z1176:Cacnb4 UTSW 2 52675812 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGGCAATGTTCAGTTAATCTCCAG -3'
(R):5'- CGTTTCCGTGACCCACATAG -3'

Sequencing Primer
(F):5'- CCAGAATTTAATCCTGTTTTTACCGG -3'
(R):5'- TCCGTGACCCACATAGCTATAATGTG -3'
Posted On2015-07-21