Incidental Mutation 'R4455:Bbs12'
ID329125
Institutional Source Beutler Lab
Gene Symbol Bbs12
Ensembl Gene ENSMUSG00000051444
Gene NameBardet-Biedl syndrome 12 (human)
SynonymsLOC241950, LOC386537, LOC241950
MMRRC Submission 041715-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R4455 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location37312554-37321453 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37320312 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 418 (V418A)
Ref Sequence ENSEMBL: ENSMUSP00000052179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057975] [ENSMUST00000108121]
Predicted Effect probably damaging
Transcript: ENSMUST00000057975
AA Change: V418A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052179
Gene: ENSMUSG00000051444
AA Change: V418A

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 22 153 5.6e-8 PFAM
Pfam:Cpn60_TCP1 299 568 4.1e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108121
AA Change: V303A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103756
Gene: ENSMUSG00000051444
AA Change: V303A

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 181 576 3.4e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138710
Meta Mutation Damage Score 0.7411 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a complex that is involved in membrane trafficking. The encoded protein is a molecular chaperone that aids in protein folding upon ATP hydrolysis. This protein also plays a role in adipocyte differentiation. Defects in this gene are a cause of Bardet-Biedl syndrome type 12. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a targeted allele exhibit enhanced adipogenesis, late onset obesity, increased susceptibility to diet-induced obesity, increased insulin sensitivity, increased glucose usage, and decreased inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,397,196 H166R possibly damaging Het
Aktip T C 8: 91,124,851 E248G probably benign Het
Ankk1 A G 9: 49,418,066 V336A probably benign Het
Aoc1 T A 6: 48,905,467 D92E probably damaging Het
Arfgef2 T C 2: 166,894,715 I1769T probably benign Het
Arfgef3 A T 10: 18,607,675 S1434T probably benign Het
Baz1a C A 12: 54,911,368 V1033L probably benign Het
Cacnb4 A G 2: 52,465,653 V214A probably damaging Het
Camk2d T C 3: 126,780,403 V153A probably damaging Het
Ccdc18 C T 5: 108,161,529 S330L possibly damaging Het
Cdh11 T C 8: 102,647,823 D500G probably benign Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Clca4a G A 3: 144,957,259 P610S probably damaging Het
Dctn1 T C 6: 83,195,049 L807P probably damaging Het
Dopey2 T C 16: 93,766,215 L869P probably damaging Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fam227b T A 2: 126,146,268 probably benign Het
Fam26f A T 10: 34,126,535 I184N probably damaging Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Grb10 T G 11: 11,967,665 Q72P possibly damaging Het
H3f3a G T 1: 180,803,103 R129S probably benign Het
Hfm1 T C 5: 106,886,508 probably null Het
Kansl1 T C 11: 104,424,358 T285A possibly damaging Het
Krtap16-1 A T 11: 99,985,733 C282S probably benign Het
Magi1 A G 6: 93,785,457 V89A probably damaging Het
Mllt1 A G 17: 56,919,965 Y71H probably damaging Het
Ms4a14 T A 19: 11,303,626 T523S possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Muc5b T C 7: 141,858,818 S1834P unknown Het
Necap1 C T 6: 122,887,369 S270F possibly damaging Het
Piwil2 T C 14: 70,390,565 M752V probably benign Het
Prune1 G A 3: 95,281,896 probably null Het
Ptpro A G 6: 137,393,659 E586G probably damaging Het
Rela T A 19: 5,647,262 I499K probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Scara5 T A 14: 65,762,747 D455E probably benign Het
Slc2a4 G A 11: 69,943,322 probably benign Het
Sntb2 G A 8: 106,991,607 probably null Het
Sspo C T 6: 48,465,516 R1982C probably damaging Het
Svs1 A T 6: 48,987,460 N134I possibly damaging Het
Tsen34 G A 7: 3,695,098 probably null Het
Ttc28 AC A 5: 111,224,058 probably null Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Utp18 G A 11: 93,885,447 R71C probably benign Het
Xrn1 T A 9: 95,973,645 probably benign Het
Yeats2 A G 16: 20,161,993 K187R possibly damaging Het
Other mutations in Bbs12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Bbs12 APN 3 37320197 missense probably damaging 1.00
IGL00698:Bbs12 APN 3 37320794 missense probably benign 0.00
IGL02105:Bbs12 APN 3 37320147 missense probably damaging 1.00
IGL02110:Bbs12 APN 3 37319187 missense probably benign 0.01
IGL03036:Bbs12 APN 3 37319194 missense possibly damaging 0.86
haribo UTSW 3 37320380 missense probably damaging 1.00
R0310:Bbs12 UTSW 3 37321045 missense probably damaging 1.00
R1888:Bbs12 UTSW 3 37320563 missense probably damaging 1.00
R1888:Bbs12 UTSW 3 37320563 missense probably damaging 1.00
R2061:Bbs12 UTSW 3 37319066 missense probably damaging 0.97
R2152:Bbs12 UTSW 3 37321160 nonsense probably null
R4472:Bbs12 UTSW 3 37319220 missense possibly damaging 0.95
R4762:Bbs12 UTSW 3 37320380 missense probably damaging 1.00
R5208:Bbs12 UTSW 3 37320273 missense probably benign 0.07
R5841:Bbs12 UTSW 3 37319521 missense probably benign 0.05
R5864:Bbs12 UTSW 3 37319490 missense probably damaging 1.00
R5872:Bbs12 UTSW 3 37320449 missense possibly damaging 0.83
R5941:Bbs12 UTSW 3 37320048 missense probably damaging 0.98
R5954:Bbs12 UTSW 3 37320002 missense possibly damaging 0.95
R6125:Bbs12 UTSW 3 37320551 missense probably benign 0.01
R6562:Bbs12 UTSW 3 37320240 missense probably damaging 1.00
R6886:Bbs12 UTSW 3 37319241 missense probably damaging 1.00
R7454:Bbs12 UTSW 3 37320953 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCAAGGAATTGCAGGATCAGC -3'
(R):5'- TCATGAGGACTCATCCAGAAGGTC -3'

Sequencing Primer
(F):5'- GGATCAGCCTTTCCGAGTGATTC -3'
(R):5'- GACTCATCCAGAAGGTCACAGAG -3'
Posted On2015-07-21