Incidental Mutation 'R4455:Hfm1'
ID329131
Institutional Source Beutler Lab
Gene Symbol Hfm1
Ensembl Gene ENSMUSG00000043410
Gene NameHFM1, ATP-dependent DNA helicase homolog
SynonymsLOC381663, A330009G12Rik, Mer3, Sec63d1
MMRRC Submission 041715-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R4455 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location106840192-106926321 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to C at 106886508 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000112690] [ENSMUST00000117588] [ENSMUST00000117588] [ENSMUST00000148495]
Predicted Effect probably null
Transcript: ENSMUST00000112690
SMART Domains Protein: ENSMUSP00000108310
Gene: ENSMUSG00000043410

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000117588
SMART Domains Protein: ENSMUSP00000112590
Gene: ENSMUSG00000043410

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000117588
SMART Domains Protein: ENSMUSP00000112590
Gene: ENSMUSG00000043410

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148495
Predicted Effect probably null
Transcript: ENSMUST00000155171
SMART Domains Protein: ENSMUSP00000118674
Gene: ENSMUSG00000043410

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
Sec63 33 304 3.04e-42 SMART
Blast:Sec63 344 402 7e-19 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000155171
SMART Domains Protein: ENSMUSP00000118674
Gene: ENSMUSG00000043410

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
Sec63 33 304 3.04e-42 SMART
Blast:Sec63 344 402 7e-19 BLAST
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be an ATP-dependent DNA helicase and is expressed mainly in germ-line cells. Defects in this gene are a cause of premature ovarian failure 9 (POF9). [provided by RefSeq, Apr 2014]
PHENOTYPE: Meiosis ais disrupted in homozygotes and bothe sexes are sterile [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,397,196 H166R possibly damaging Het
Aktip T C 8: 91,124,851 E248G probably benign Het
Ankk1 A G 9: 49,418,066 V336A probably benign Het
Aoc1 T A 6: 48,905,467 D92E probably damaging Het
Arfgef2 T C 2: 166,894,715 I1769T probably benign Het
Arfgef3 A T 10: 18,607,675 S1434T probably benign Het
Baz1a C A 12: 54,911,368 V1033L probably benign Het
Bbs12 T C 3: 37,320,312 V418A probably damaging Het
Cacnb4 A G 2: 52,465,653 V214A probably damaging Het
Camk2d T C 3: 126,780,403 V153A probably damaging Het
Ccdc18 C T 5: 108,161,529 S330L possibly damaging Het
Cdh11 T C 8: 102,647,823 D500G probably benign Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Clca4a G A 3: 144,957,259 P610S probably damaging Het
Dctn1 T C 6: 83,195,049 L807P probably damaging Het
Dopey2 T C 16: 93,766,215 L869P probably damaging Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fam227b T A 2: 126,146,268 probably benign Het
Fam26f A T 10: 34,126,535 I184N probably damaging Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Grb10 T G 11: 11,967,665 Q72P possibly damaging Het
H3f3a G T 1: 180,803,103 R129S probably benign Het
Kansl1 T C 11: 104,424,358 T285A possibly damaging Het
Krtap16-1 A T 11: 99,985,733 C282S probably benign Het
Magi1 A G 6: 93,785,457 V89A probably damaging Het
Mllt1 A G 17: 56,919,965 Y71H probably damaging Het
Ms4a14 T A 19: 11,303,626 T523S possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Muc5b T C 7: 141,858,818 S1834P unknown Het
Necap1 C T 6: 122,887,369 S270F possibly damaging Het
Piwil2 T C 14: 70,390,565 M752V probably benign Het
Prune1 G A 3: 95,281,896 probably null Het
Ptpro A G 6: 137,393,659 E586G probably damaging Het
Rela T A 19: 5,647,262 I499K probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Scara5 T A 14: 65,762,747 D455E probably benign Het
Slc2a4 G A 11: 69,943,322 probably benign Het
Sntb2 G A 8: 106,991,607 probably null Het
Sspo C T 6: 48,465,516 R1982C probably damaging Het
Svs1 A T 6: 48,987,460 N134I possibly damaging Het
Tsen34 G A 7: 3,695,098 probably null Het
Ttc28 AC A 5: 111,224,058 probably null Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Utp18 G A 11: 93,885,447 R71C probably benign Het
Xrn1 T A 9: 95,973,645 probably benign Het
Yeats2 A G 16: 20,161,993 K187R possibly damaging Het
Other mutations in Hfm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Hfm1 APN 5 106902130 missense possibly damaging 0.70
IGL01295:Hfm1 APN 5 106917606 missense possibly damaging 0.46
IGL01725:Hfm1 APN 5 106917379 missense probably benign 0.00
IGL01758:Hfm1 APN 5 106904793 missense probably damaging 0.99
IGL01911:Hfm1 APN 5 106911544 missense possibly damaging 0.92
IGL02337:Hfm1 APN 5 106904267 missense possibly damaging 0.81
IGL02472:Hfm1 APN 5 106873928 splice site probably benign
IGL02496:Hfm1 APN 5 106901761 missense probably benign 0.00
IGL02545:Hfm1 APN 5 106895287 missense probably damaging 1.00
IGL02584:Hfm1 APN 5 106878662 intron probably null
IGL02728:Hfm1 APN 5 106878823 missense probably benign 0.13
IGL02881:Hfm1 APN 5 106874252 missense probably damaging 1.00
IGL03108:Hfm1 APN 5 106895934 unclassified probably benign
IGL03351:Hfm1 APN 5 106911575 nonsense probably null
IGL03353:Hfm1 APN 5 106856929 missense probably damaging 0.99
R0024:Hfm1 UTSW 5 106856924 missense probably benign 0.41
R0024:Hfm1 UTSW 5 106856924 missense probably benign 0.41
R0094:Hfm1 UTSW 5 106917478 missense probably benign
R0633:Hfm1 UTSW 5 106917601 missense possibly damaging 0.56
R0644:Hfm1 UTSW 5 106898256 critical splice donor site probably null
R1078:Hfm1 UTSW 5 106878830 missense probably damaging 1.00
R1120:Hfm1 UTSW 5 106904218 splice site probably benign
R1166:Hfm1 UTSW 5 106911411 missense probably benign 0.00
R1242:Hfm1 UTSW 5 106874901 missense probably damaging 0.99
R1414:Hfm1 UTSW 5 106872353 missense probably benign 0.01
R1450:Hfm1 UTSW 5 106918458 missense probably damaging 0.99
R1529:Hfm1 UTSW 5 106853123 missense probably benign 0.00
R1622:Hfm1 UTSW 5 106893523 missense possibly damaging 0.58
R1710:Hfm1 UTSW 5 106880514 missense probably damaging 1.00
R1710:Hfm1 UTSW 5 106896003 missense probably damaging 0.96
R1757:Hfm1 UTSW 5 106880360 splice site probably null
R1856:Hfm1 UTSW 5 106847676 missense probably benign 0.00
R1984:Hfm1 UTSW 5 106898576 missense probably damaging 0.98
R1985:Hfm1 UTSW 5 106898576 missense probably damaging 0.98
R2040:Hfm1 UTSW 5 106901818 missense probably damaging 1.00
R2122:Hfm1 UTSW 5 106896255 missense probably damaging 1.00
R2426:Hfm1 UTSW 5 106847653 splice site probably null
R2474:Hfm1 UTSW 5 106872416 missense possibly damaging 0.81
R2926:Hfm1 UTSW 5 106874282 nonsense probably null
R2944:Hfm1 UTSW 5 106872330 missense probably damaging 1.00
R3705:Hfm1 UTSW 5 106892839 unclassified probably benign
R4256:Hfm1 UTSW 5 106904797 missense possibly damaging 0.83
R4538:Hfm1 UTSW 5 106874890 missense possibly damaging 0.47
R4540:Hfm1 UTSW 5 106874221 nonsense probably null
R4591:Hfm1 UTSW 5 106847667 missense probably benign 0.08
R4745:Hfm1 UTSW 5 106901843 missense possibly damaging 0.87
R4747:Hfm1 UTSW 5 106917523 missense probably benign
R4765:Hfm1 UTSW 5 106842539 missense probably benign 0.21
R4821:Hfm1 UTSW 5 106854740 critical splice donor site probably null
R4842:Hfm1 UTSW 5 106892751 missense probably damaging 1.00
R4944:Hfm1 UTSW 5 106874213 missense possibly damaging 0.46
R5093:Hfm1 UTSW 5 106901731 missense probably damaging 1.00
R5399:Hfm1 UTSW 5 106917562 missense possibly damaging 0.91
R5414:Hfm1 UTSW 5 106902076 missense probably damaging 1.00
R5436:Hfm1 UTSW 5 106892772 missense possibly damaging 0.61
R5459:Hfm1 UTSW 5 106904763 missense probably damaging 1.00
R5485:Hfm1 UTSW 5 106847662 critical splice donor site probably null
R5585:Hfm1 UTSW 5 106911439 missense probably benign 0.05
R5631:Hfm1 UTSW 5 106904763 missense probably damaging 1.00
R5705:Hfm1 UTSW 5 106911453 missense probably benign 0.21
R5804:Hfm1 UTSW 5 106878589 intron probably null
R5959:Hfm1 UTSW 5 106874917 missense probably damaging 1.00
R6046:Hfm1 UTSW 5 106898643 splice site probably null
R6191:Hfm1 UTSW 5 106886553 missense possibly damaging 0.95
R6345:Hfm1 UTSW 5 106841638 missense probably benign
R6580:Hfm1 UTSW 5 106847709 missense probably benign 0.00
R6651:Hfm1 UTSW 5 106847687 missense probably benign 0.00
R6761:Hfm1 UTSW 5 106895279 missense probably damaging 1.00
R6835:Hfm1 UTSW 5 106878815 nonsense probably null
R6891:Hfm1 UTSW 5 106917374 missense possibly damaging 0.49
R6924:Hfm1 UTSW 5 106850410 intron probably null
R6980:Hfm1 UTSW 5 106880477 missense probably benign 0.31
R7054:Hfm1 UTSW 5 106896043 missense probably benign 0.01
R7058:Hfm1 UTSW 5 106911440 missense probably benign 0.04
R7189:Hfm1 UTSW 5 106901703 critical splice donor site probably null
R7250:Hfm1 UTSW 5 106904331 missense probably benign 0.00
R7376:Hfm1 UTSW 5 106895218 missense possibly damaging 0.95
R7577:Hfm1 UTSW 5 106896043 missense probably benign 0.01
R7636:Hfm1 UTSW 5 106917466 missense probably benign 0.02
R7639:Hfm1 UTSW 5 106889925 missense probably benign 0.03
R7639:Hfm1 UTSW 5 106898475 missense possibly damaging 0.46
R7763:Hfm1 UTSW 5 106881861 missense probably damaging 1.00
R7828:Hfm1 UTSW 5 106881791 critical splice donor site probably null
R7905:Hfm1 UTSW 5 106898553 missense probably damaging 1.00
R7988:Hfm1 UTSW 5 106898553 missense probably damaging 1.00
Z1177:Hfm1 UTSW 5 106871820 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTGAGAAAGAAAACGTGTCACTC -3'
(R):5'- TAAAGGCTCCAGTTCTTCCAG -3'

Sequencing Primer
(F):5'- CGTGTCACTCGATTATTTACTAGATG -3'
(R):5'- GCTATATAGCAGACATCTTCA -3'
Posted On2015-07-21