Incidental Mutation 'R4455:Aktip'
ID329144
Institutional Source Beutler Lab
Gene Symbol Aktip
Ensembl Gene ENSMUSG00000031667
Gene Namethymoma viral proto-oncogene 1 interacting protein
SynonymsFt1
MMRRC Submission 041715-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4455 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location91111784-91199976 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91124851 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 248 (E248G)
Ref Sequence ENSEMBL: ENSMUSP00000119277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034091] [ENSMUST00000109609] [ENSMUST00000120213] [ENSMUST00000120349] [ENSMUST00000120426] [ENSMUST00000125257] [ENSMUST00000209311] [ENSMUST00000209444] [ENSMUST00000209518] [ENSMUST00000211136]
Predicted Effect probably benign
Transcript: ENSMUST00000034091
SMART Domains Protein: ENSMUSP00000034091
Gene: ENSMUSG00000031666

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
CYCLIN 44 131 5.81e-1 SMART
DUF3452 94 236 2.36e-77 SMART
low complexity region 301 313 N/A INTRINSIC
RB_A 414 606 3.42e-106 SMART
low complexity region 722 733 N/A INTRINSIC
low complexity region 758 771 N/A INTRINSIC
low complexity region 776 789 N/A INTRINSIC
low complexity region 804 818 N/A INTRINSIC
CYCLIN 845 1008 2.86e-6 SMART
Rb_C 1019 1135 5.42e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109609
AA Change: E248G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105238
Gene: ENSMUSG00000031667
AA Change: E248G

DomainStartEndE-ValueType
UBCc 77 222 3.97e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120213
AA Change: E248G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112375
Gene: ENSMUSG00000031667
AA Change: E248G

DomainStartEndE-ValueType
UBCc 77 222 3.97e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120349
AA Change: E248G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113769
Gene: ENSMUSG00000031667
AA Change: E248G

DomainStartEndE-ValueType
UBCc 77 222 3.97e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120426
AA Change: E248G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113379
Gene: ENSMUSG00000031667
AA Change: E248G

DomainStartEndE-ValueType
UBCc 77 222 3.97e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125257
AA Change: E248G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119277
Gene: ENSMUSG00000031667
AA Change: E248G

DomainStartEndE-ValueType
UBCc 77 222 3.97e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209311
Predicted Effect probably benign
Transcript: ENSMUST00000209444
Predicted Effect probably benign
Transcript: ENSMUST00000209518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210426
Predicted Effect probably benign
Transcript: ENSMUST00000211050
Predicted Effect probably benign
Transcript: ENSMUST00000211136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211618
Meta Mutation Damage Score 0.0701 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The mouse homolog of this gene produces fused toes and thymic hyperplasia in heterozygous mutant animals while homozygous mutants die in early development. This gene may play a role in apoptosis as these morphological abnormalities are caused by altered patterns of programmed cell death. The protein encoded by this gene is similar to the ubiquitin ligase domain of other ubiquitin-conjugating enzymes but lacks the conserved cysteine residue that enables those enzymes to conjugate ubiquitin to the target protein. This protein interacts directly with serine/threonine kinase protein kinase B (PKB)/Akt and modulates PKB activity by enhancing the phosphorylation of PKB's regulatory sites. Alternative splicing results in two transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,397,196 H166R possibly damaging Het
Ankk1 A G 9: 49,418,066 V336A probably benign Het
Aoc1 T A 6: 48,905,467 D92E probably damaging Het
Arfgef2 T C 2: 166,894,715 I1769T probably benign Het
Arfgef3 A T 10: 18,607,675 S1434T probably benign Het
Baz1a C A 12: 54,911,368 V1033L probably benign Het
Bbs12 T C 3: 37,320,312 V418A probably damaging Het
Cacnb4 A G 2: 52,465,653 V214A probably damaging Het
Camk2d T C 3: 126,780,403 V153A probably damaging Het
Ccdc18 C T 5: 108,161,529 S330L possibly damaging Het
Cdh11 T C 8: 102,647,823 D500G probably benign Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Clca4a G A 3: 144,957,259 P610S probably damaging Het
Dctn1 T C 6: 83,195,049 L807P probably damaging Het
Dopey2 T C 16: 93,766,215 L869P probably damaging Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fam227b T A 2: 126,146,268 probably benign Het
Fam26f A T 10: 34,126,535 I184N probably damaging Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Grb10 T G 11: 11,967,665 Q72P possibly damaging Het
H3f3a G T 1: 180,803,103 R129S probably benign Het
Hfm1 T C 5: 106,886,508 probably null Het
Kansl1 T C 11: 104,424,358 T285A possibly damaging Het
Krtap16-1 A T 11: 99,985,733 C282S probably benign Het
Magi1 A G 6: 93,785,457 V89A probably damaging Het
Mllt1 A G 17: 56,919,965 Y71H probably damaging Het
Ms4a14 T A 19: 11,303,626 T523S possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Muc5b T C 7: 141,858,818 S1834P unknown Het
Necap1 C T 6: 122,887,369 S270F possibly damaging Het
Piwil2 T C 14: 70,390,565 M752V probably benign Het
Prune1 G A 3: 95,281,896 probably null Het
Ptpro A G 6: 137,393,659 E586G probably damaging Het
Rela T A 19: 5,647,262 I499K probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Scara5 T A 14: 65,762,747 D455E probably benign Het
Slc2a4 G A 11: 69,943,322 probably benign Het
Sntb2 G A 8: 106,991,607 probably null Het
Sspo C T 6: 48,465,516 R1982C probably damaging Het
Svs1 A T 6: 48,987,460 N134I possibly damaging Het
Tsen34 G A 7: 3,695,098 probably null Het
Ttc28 AC A 5: 111,224,058 probably null Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Utp18 G A 11: 93,885,447 R71C probably benign Het
Xrn1 T A 9: 95,973,645 probably benign Het
Yeats2 A G 16: 20,161,993 K187R possibly damaging Het
Other mutations in Aktip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01958:Aktip APN 8 91126225 missense probably damaging 1.00
IGL02351:Aktip APN 8 91126892 missense possibly damaging 0.73
IGL02358:Aktip APN 8 91126892 missense possibly damaging 0.73
IGL03085:Aktip APN 8 91126023 critical splice donor site probably null
R1564:Aktip UTSW 8 91131081 start codon destroyed probably null 0.94
R1809:Aktip UTSW 8 91129720 missense probably damaging 1.00
R1851:Aktip UTSW 8 91125877 missense possibly damaging 0.93
R4067:Aktip UTSW 8 91125838 missense possibly damaging 0.87
R5052:Aktip UTSW 8 91129651 missense possibly damaging 0.47
R5330:Aktip UTSW 8 91126724 missense probably damaging 0.98
R6134:Aktip UTSW 8 91129760 missense probably damaging 1.00
R6178:Aktip UTSW 8 91126043 missense probably damaging 0.98
R6984:Aktip UTSW 8 91126718 missense probably damaging 1.00
R7672:Aktip UTSW 8 91129657 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- ATCAGGCTTCTTCTGGGCAC -3'
(R):5'- GCTCTTTAGCCAGGGATATGG -3'

Sequencing Primer
(F):5'- TTCTTCTGGGCACAATCAAAAACAG -3'
(R):5'- CCTGGTCTAAAGGGCAAGTTC -3'
Posted On2015-07-21