Incidental Mutation 'R4455:Arfgef3'
ID329151
Institutional Source Beutler Lab
Gene Symbol Arfgef3
Ensembl Gene ENSMUSG00000019852
Gene NameARFGEF family member 3
SynonymsB930094H20Rik, D10Bwg1379e, BIG3
MMRRC Submission 041715-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R4455 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location18581839-18743949 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18607675 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1434 (S1434T)
Ref Sequence ENSEMBL: ENSMUSP00000149210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019999] [ENSMUST00000215836]
Predicted Effect probably benign
Transcript: ENSMUST00000019999
AA Change: S1434T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000019999
Gene: ENSMUSG00000019852
AA Change: S1434T

DomainStartEndE-ValueType
Pfam:DCB 1 170 7.1e-15 PFAM
low complexity region 236 245 N/A INTRINSIC
low complexity region 276 295 N/A INTRINSIC
low complexity region 452 462 N/A INTRINSIC
Sec7 582 794 6e-54 SMART
Blast:Sec7 798 873 3e-20 BLAST
low complexity region 927 940 N/A INTRINSIC
Pfam:DUF1981 1237 1312 1.9e-14 PFAM
low complexity region 1641 1652 N/A INTRINSIC
low complexity region 1710 1723 N/A INTRINSIC
low complexity region 1838 1856 N/A INTRINSIC
low complexity region 2088 2099 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215836
AA Change: S1434T

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0659 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (61/61)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased insulin granule biogenesis and insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,397,196 H166R possibly damaging Het
Aktip T C 8: 91,124,851 E248G probably benign Het
Ankk1 A G 9: 49,418,066 V336A probably benign Het
Aoc1 T A 6: 48,905,467 D92E probably damaging Het
Arfgef2 T C 2: 166,894,715 I1769T probably benign Het
Baz1a C A 12: 54,911,368 V1033L probably benign Het
Bbs12 T C 3: 37,320,312 V418A probably damaging Het
Cacnb4 A G 2: 52,465,653 V214A probably damaging Het
Camk2d T C 3: 126,780,403 V153A probably damaging Het
Ccdc18 C T 5: 108,161,529 S330L possibly damaging Het
Cdh11 T C 8: 102,647,823 D500G probably benign Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Clca4a G A 3: 144,957,259 P610S probably damaging Het
Dctn1 T C 6: 83,195,049 L807P probably damaging Het
Dopey2 T C 16: 93,766,215 L869P probably damaging Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fam227b T A 2: 126,146,268 probably benign Het
Fam26f A T 10: 34,126,535 I184N probably damaging Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Grb10 T G 11: 11,967,665 Q72P possibly damaging Het
H3f3a G T 1: 180,803,103 R129S probably benign Het
Hfm1 T C 5: 106,886,508 probably null Het
Kansl1 T C 11: 104,424,358 T285A possibly damaging Het
Krtap16-1 A T 11: 99,985,733 C282S probably benign Het
Magi1 A G 6: 93,785,457 V89A probably damaging Het
Mllt1 A G 17: 56,919,965 Y71H probably damaging Het
Ms4a14 T A 19: 11,303,626 T523S possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Muc5b T C 7: 141,858,818 S1834P unknown Het
Necap1 C T 6: 122,887,369 S270F possibly damaging Het
Piwil2 T C 14: 70,390,565 M752V probably benign Het
Prune1 G A 3: 95,281,896 probably null Het
Ptpro A G 6: 137,393,659 E586G probably damaging Het
Rela T A 19: 5,647,262 I499K probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Scara5 T A 14: 65,762,747 D455E probably benign Het
Slc2a4 G A 11: 69,943,322 probably benign Het
Sntb2 G A 8: 106,991,607 probably null Het
Sspo C T 6: 48,465,516 R1982C probably damaging Het
Svs1 A T 6: 48,987,460 N134I possibly damaging Het
Tsen34 G A 7: 3,695,098 probably null Het
Ttc28 AC A 5: 111,224,058 probably null Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Utp18 G A 11: 93,885,447 R71C probably benign Het
Xrn1 T A 9: 95,973,645 probably benign Het
Yeats2 A G 16: 20,161,993 K187R possibly damaging Het
Other mutations in Arfgef3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Arfgef3 APN 10 18660604 missense probably benign 0.03
IGL00835:Arfgef3 APN 10 18661358 missense probably benign
IGL00961:Arfgef3 APN 10 18611237 missense probably damaging 1.00
IGL01400:Arfgef3 APN 10 18652706 missense probably damaging 1.00
IGL01501:Arfgef3 APN 10 18600560 missense possibly damaging 0.93
IGL01595:Arfgef3 APN 10 18594912 missense possibly damaging 0.93
IGL01695:Arfgef3 APN 10 18603419 missense probably benign 0.00
IGL01774:Arfgef3 APN 10 18743615 missense possibly damaging 0.94
IGL02348:Arfgef3 APN 10 18591347 missense probably benign 0.04
IGL02371:Arfgef3 APN 10 18646539 missense probably benign
IGL02400:Arfgef3 APN 10 18646257 missense probably damaging 1.00
IGL02630:Arfgef3 APN 10 18661392 splice site probably benign
IGL02815:Arfgef3 APN 10 18652551 missense probably damaging 1.00
IGL03178:Arfgef3 APN 10 18613225 missense probably damaging 1.00
IGL03182:Arfgef3 APN 10 18600544 missense probably damaging 1.00
IGL03267:Arfgef3 APN 10 18591882 missense probably damaging 1.00
IGL03294:Arfgef3 APN 10 18664912 missense probably damaging 0.97
IGL03410:Arfgef3 APN 10 18600490 missense probably damaging 1.00
Bow-wow UTSW 10 18646730 nonsense probably null
R0098:Arfgef3 UTSW 10 18589642 missense probably damaging 1.00
R0098:Arfgef3 UTSW 10 18589642 missense probably damaging 1.00
R0141:Arfgef3 UTSW 10 18597407 missense probably damaging 1.00
R0164:Arfgef3 UTSW 10 18647915 missense possibly damaging 0.77
R0164:Arfgef3 UTSW 10 18647915 missense possibly damaging 0.77
R0241:Arfgef3 UTSW 10 18599214 missense probably damaging 1.00
R0334:Arfgef3 UTSW 10 18592281 missense probably damaging 0.98
R0352:Arfgef3 UTSW 10 18661387 missense probably benign 0.17
R0415:Arfgef3 UTSW 10 18613127 splice site probably benign
R0417:Arfgef3 UTSW 10 18603511 missense probably damaging 1.00
R0442:Arfgef3 UTSW 10 18677815 splice site probably benign
R0507:Arfgef3 UTSW 10 18591621 missense probably damaging 1.00
R0573:Arfgef3 UTSW 10 18599288 missense probably damaging 1.00
R0582:Arfgef3 UTSW 10 18611290 missense probably damaging 1.00
R0609:Arfgef3 UTSW 10 18597431 missense probably benign 0.31
R0826:Arfgef3 UTSW 10 18589666 missense probably damaging 0.98
R0919:Arfgef3 UTSW 10 18589735 missense possibly damaging 0.89
R0980:Arfgef3 UTSW 10 18592118 missense possibly damaging 0.82
R1027:Arfgef3 UTSW 10 18591375 missense probably benign 0.02
R1140:Arfgef3 UTSW 10 18597348 missense possibly damaging 0.77
R1491:Arfgef3 UTSW 10 18646554 missense probably damaging 1.00
R1493:Arfgef3 UTSW 10 18630879 missense probably damaging 0.96
R1529:Arfgef3 UTSW 10 18613222 nonsense probably null
R1564:Arfgef3 UTSW 10 18591704 missense probably damaging 1.00
R1654:Arfgef3 UTSW 10 18625148 missense probably null 0.15
R1868:Arfgef3 UTSW 10 18661387 missense probably benign 0.17
R1876:Arfgef3 UTSW 10 18597356 missense probably damaging 1.00
R1908:Arfgef3 UTSW 10 18652763 missense possibly damaging 0.80
R2211:Arfgef3 UTSW 10 18592245 missense possibly damaging 0.54
R2316:Arfgef3 UTSW 10 18616953 missense probably benign 0.19
R2393:Arfgef3 UTSW 10 18597787 missense possibly damaging 0.88
R2407:Arfgef3 UTSW 10 18677866 missense possibly damaging 0.63
R3076:Arfgef3 UTSW 10 18603530 missense probably damaging 0.99
R3077:Arfgef3 UTSW 10 18603530 missense probably damaging 0.99
R3963:Arfgef3 UTSW 10 18592277 missense probably damaging 1.00
R4201:Arfgef3 UTSW 10 18619782 missense probably benign 0.01
R4241:Arfgef3 UTSW 10 18625164 missense probably damaging 1.00
R4244:Arfgef3 UTSW 10 18630420 missense probably damaging 1.00
R4395:Arfgef3 UTSW 10 18597709 missense probably damaging 1.00
R4480:Arfgef3 UTSW 10 18600600 missense probably damaging 1.00
R4499:Arfgef3 UTSW 10 18608343 missense possibly damaging 0.95
R4589:Arfgef3 UTSW 10 18646199 missense probably damaging 1.00
R4635:Arfgef3 UTSW 10 18634855 missense probably damaging 1.00
R4776:Arfgef3 UTSW 10 18654247 missense probably benign
R4801:Arfgef3 UTSW 10 18591906 missense probably benign 0.00
R4802:Arfgef3 UTSW 10 18591906 missense probably benign 0.00
R4807:Arfgef3 UTSW 10 18646637 missense probably benign
R4828:Arfgef3 UTSW 10 18652693 missense probably damaging 0.99
R4861:Arfgef3 UTSW 10 18607731 missense probably benign 0.01
R4861:Arfgef3 UTSW 10 18607731 missense probably benign 0.01
R4917:Arfgef3 UTSW 10 18616890 missense probably damaging 0.99
R4918:Arfgef3 UTSW 10 18616890 missense probably damaging 0.99
R4922:Arfgef3 UTSW 10 18592186 missense probably damaging 0.97
R4929:Arfgef3 UTSW 10 18630851 missense probably benign 0.00
R4937:Arfgef3 UTSW 10 18589706 missense probably damaging 0.98
R5290:Arfgef3 UTSW 10 18600460 missense probably damaging 1.00
R5410:Arfgef3 UTSW 10 18611237 missense probably damaging 0.99
R5807:Arfgef3 UTSW 10 18647798 splice site probably null
R5832:Arfgef3 UTSW 10 18630420 missense probably damaging 1.00
R5887:Arfgef3 UTSW 10 18607665 nonsense probably null
R6272:Arfgef3 UTSW 10 18646963 missense probably benign 0.00
R6302:Arfgef3 UTSW 10 18652841 missense probably damaging 0.97
R6397:Arfgef3 UTSW 10 18607665 nonsense probably null
R6495:Arfgef3 UTSW 10 18611202 critical splice donor site probably null
R6707:Arfgef3 UTSW 10 18621155 missense probably benign 0.11
R6814:Arfgef3 UTSW 10 18595019 missense probably damaging 1.00
R6830:Arfgef3 UTSW 10 18664889 critical splice donor site probably null
R6870:Arfgef3 UTSW 10 18646730 nonsense probably null
R6941:Arfgef3 UTSW 10 18625455 missense possibly damaging 0.66
R7094:Arfgef3 UTSW 10 18646439 missense probably damaging 1.00
R7179:Arfgef3 UTSW 10 18599267 missense probably damaging 1.00
R7204:Arfgef3 UTSW 10 18646462 missense probably damaging 1.00
R7247:Arfgef3 UTSW 10 18625391 missense probably benign 0.00
R7249:Arfgef3 UTSW 10 18630835 missense possibly damaging 0.62
R7318:Arfgef3 UTSW 10 18630463 missense possibly damaging 0.89
R7391:Arfgef3 UTSW 10 18646259 missense probably benign 0.05
R7527:Arfgef3 UTSW 10 18646629 missense probably benign
R7618:Arfgef3 UTSW 10 18646281 missense probably damaging 1.00
R7779:Arfgef3 UTSW 10 18595023 missense probably damaging 0.99
R7851:Arfgef3 UTSW 10 18592286 missense probably damaging 1.00
R7934:Arfgef3 UTSW 10 18592286 missense probably damaging 1.00
X0026:Arfgef3 UTSW 10 18652626 missense probably damaging 1.00
Z1176:Arfgef3 UTSW 10 18591437 missense probably damaging 1.00
Z1176:Arfgef3 UTSW 10 18608358 missense probably damaging 0.97
Z1176:Arfgef3 UTSW 10 18634852 missense probably benign 0.26
Z1177:Arfgef3 UTSW 10 18607776 missense probably damaging 1.00
Z1177:Arfgef3 UTSW 10 18627628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATGTAAGAACAAGTTGGTGTTG -3'
(R):5'- TCCTGACACTGAGAATTTCCC -3'

Sequencing Primer
(F):5'- CTTTAGGGAATCCTTGGAAACGC -3'
(R):5'- TCCCAATATATAAGTGAACTGTTTGG -3'
Posted On2015-07-21