Incidental Mutation 'R4455:Krtap16-1'
ID329159
Institutional Source Beutler Lab
Gene Symbol Krtap16-1
Ensembl Gene ENSMUSG00000078253
Gene Namekeratin associated protein 16-1
SynonymsAI450886
MMRRC Submission 041715-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R4455 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location99984710-99986597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99985733 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 282 (C282S)
Ref Sequence ENSEMBL: ENSMUSP00000100671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105050]
Predicted Effect probably benign
Transcript: ENSMUST00000105050
AA Change: C282S

PolyPhen 2 Score 0.445 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000100671
Gene: ENSMUSG00000078253
AA Change: C282S

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 45 92 3.4e-8 PFAM
Pfam:Keratin_B2_2 88 132 1.8e-11 PFAM
Pfam:Keratin_B2_2 142 191 1.6e-7 PFAM
Pfam:Keratin_B2_2 172 221 9.9e-9 PFAM
Pfam:Keratin_B2_2 198 246 8.2e-5 PFAM
Pfam:Keratin_B2_2 212 266 3.3e-4 PFAM
low complexity region 282 299 N/A INTRINSIC
low complexity region 330 350 N/A INTRINSIC
low complexity region 370 382 N/A INTRINSIC
low complexity region 489 500 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118454
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,397,196 H166R possibly damaging Het
Aktip T C 8: 91,124,851 E248G probably benign Het
Ankk1 A G 9: 49,418,066 V336A probably benign Het
Aoc1 T A 6: 48,905,467 D92E probably damaging Het
Arfgef2 T C 2: 166,894,715 I1769T probably benign Het
Arfgef3 A T 10: 18,607,675 S1434T probably benign Het
Baz1a C A 12: 54,911,368 V1033L probably benign Het
Bbs12 T C 3: 37,320,312 V418A probably damaging Het
Cacnb4 A G 2: 52,465,653 V214A probably damaging Het
Camk2d T C 3: 126,780,403 V153A probably damaging Het
Ccdc18 C T 5: 108,161,529 S330L possibly damaging Het
Cdh11 T C 8: 102,647,823 D500G probably benign Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Clca4a G A 3: 144,957,259 P610S probably damaging Het
Dctn1 T C 6: 83,195,049 L807P probably damaging Het
Dopey2 T C 16: 93,766,215 L869P probably damaging Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fam227b T A 2: 126,146,268 probably benign Het
Fam26f A T 10: 34,126,535 I184N probably damaging Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Grb10 T G 11: 11,967,665 Q72P possibly damaging Het
H3f3a G T 1: 180,803,103 R129S probably benign Het
Hfm1 T C 5: 106,886,508 probably null Het
Kansl1 T C 11: 104,424,358 T285A possibly damaging Het
Magi1 A G 6: 93,785,457 V89A probably damaging Het
Mllt1 A G 17: 56,919,965 Y71H probably damaging Het
Ms4a14 T A 19: 11,303,626 T523S possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Muc5b T C 7: 141,858,818 S1834P unknown Het
Necap1 C T 6: 122,887,369 S270F possibly damaging Het
Piwil2 T C 14: 70,390,565 M752V probably benign Het
Prune1 G A 3: 95,281,896 probably null Het
Ptpro A G 6: 137,393,659 E586G probably damaging Het
Rela T A 19: 5,647,262 I499K probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Scara5 T A 14: 65,762,747 D455E probably benign Het
Slc2a4 G A 11: 69,943,322 probably benign Het
Sntb2 G A 8: 106,991,607 probably null Het
Sspo C T 6: 48,465,516 R1982C probably damaging Het
Svs1 A T 6: 48,987,460 N134I possibly damaging Het
Tsen34 G A 7: 3,695,098 probably null Het
Ttc28 AC A 5: 111,224,058 probably null Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Utp18 G A 11: 93,885,447 R71C probably benign Het
Xrn1 T A 9: 95,973,645 probably benign Het
Yeats2 A G 16: 20,161,993 K187R possibly damaging Het
Other mutations in Krtap16-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Krtap16-1 APN 11 99985731 nonsense probably null
IGL00578:Krtap16-1 APN 11 99985295 missense probably benign 0.00
IGL02324:Krtap16-1 APN 11 99986303 missense probably damaging 0.99
R0200:Krtap16-1 UTSW 11 99985297 missense probably damaging 0.96
R0617:Krtap16-1 UTSW 11 99986495 missense probably damaging 1.00
R1699:Krtap16-1 UTSW 11 99986026 missense probably damaging 1.00
R1785:Krtap16-1 UTSW 11 99985776 nonsense probably null
R2130:Krtap16-1 UTSW 11 99985776 nonsense probably null
R2177:Krtap16-1 UTSW 11 99986449 missense probably damaging 0.99
R4716:Krtap16-1 UTSW 11 99985174 missense probably damaging 0.99
R5111:Krtap16-1 UTSW 11 99986552 missense possibly damaging 0.90
R5122:Krtap16-1 UTSW 11 99985697 missense probably damaging 0.96
R5254:Krtap16-1 UTSW 11 99985598 nonsense probably null
R5481:Krtap16-1 UTSW 11 99985327 missense probably damaging 0.98
R6557:Krtap16-1 UTSW 11 99985130 missense possibly damaging 0.90
R6884:Krtap16-1 UTSW 11 99986458 nonsense probably null
R7085:Krtap16-1 UTSW 11 99986285 missense possibly damaging 0.56
R7675:Krtap16-1 UTSW 11 99985433 missense possibly damaging 0.52
Z1176:Krtap16-1 UTSW 11 99985597 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AAACTGGACTACAAGGCGGC -3'
(R):5'- ACCAATGATCTGTGAGCCTGTG -3'

Sequencing Primer
(F):5'- CAAGCTGGTTGGCAGATGGC -3'
(R):5'- TTGCTGCCAGCCAGTGTG -3'
Posted On2015-07-21