Incidental Mutation 'R4455:Mslnl'
ID 329168
Institutional Source Beutler Lab
Gene Symbol Mslnl
Ensembl Gene ENSMUSG00000041062
Gene Name mesothelin-like
Synonyms
MMRRC Submission 041715-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4455 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 25955016-25967304 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 25961908 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 128 (V128M)
Ref Sequence ENSEMBL: ENSMUSP00000049020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047098]
AlphaFold Q8C160
Predicted Effect probably damaging
Transcript: ENSMUST00000047098
AA Change: V128M

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049020
Gene: ENSMUSG00000041062
AA Change: V128M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Mesothelin 29 589 2.8e-70 PFAM
low complexity region 633 653 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102319
Meta Mutation Damage Score 0.2148 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,274,395 (GRCm39) H166R possibly damaging Het
Aktip T C 8: 91,851,479 (GRCm39) E248G probably benign Het
Ankk1 A G 9: 49,329,366 (GRCm39) V336A probably benign Het
Aoc1 T A 6: 48,882,401 (GRCm39) D92E probably damaging Het
Aoc1l3 A T 6: 48,964,394 (GRCm39) N134I possibly damaging Het
Arfgef2 T C 2: 166,736,635 (GRCm39) I1769T probably benign Het
Arfgef3 A T 10: 18,483,423 (GRCm39) S1434T probably benign Het
Baz1a C A 12: 54,958,153 (GRCm39) V1033L probably benign Het
Bbs12 T C 3: 37,374,461 (GRCm39) V418A probably damaging Het
Cacnb4 A G 2: 52,355,665 (GRCm39) V214A probably damaging Het
Calhm6 A T 10: 34,002,531 (GRCm39) I184N probably damaging Het
Camk2d T C 3: 126,574,052 (GRCm39) V153A probably damaging Het
Ccdc18 C T 5: 108,309,395 (GRCm39) S330L possibly damaging Het
Cdh11 T C 8: 103,374,455 (GRCm39) D500G probably benign Het
Cdkn2d C G 9: 21,202,185 (GRCm39) V21L probably benign Het
Clca4a G A 3: 144,663,020 (GRCm39) P610S probably damaging Het
Dctn1 T C 6: 83,172,031 (GRCm39) L807P probably damaging Het
Dop1b T C 16: 93,563,103 (GRCm39) L869P probably damaging Het
Egr2 GAA GA 10: 67,375,733 (GRCm39) probably null Het
Eya1 C T 1: 14,253,420 (GRCm39) V519M probably damaging Het
Fam227b T A 2: 125,988,188 (GRCm39) probably benign Het
Fsip2 G T 2: 82,821,120 (GRCm39) A5618S possibly damaging Het
Grb10 T G 11: 11,917,665 (GRCm39) Q72P possibly damaging Het
H3f3a G T 1: 180,630,668 (GRCm39) R129S probably benign Het
Hfm1 T C 5: 107,034,374 (GRCm39) probably null Het
Kansl1 T C 11: 104,315,184 (GRCm39) T285A possibly damaging Het
Krtap16-1 A T 11: 99,876,559 (GRCm39) C282S probably benign Het
Magi1 A G 6: 93,762,438 (GRCm39) V89A probably damaging Het
Mllt1 A G 17: 57,226,965 (GRCm39) Y71H probably damaging Het
Ms4a14 T A 19: 11,280,990 (GRCm39) T523S possibly damaging Het
Muc5b T C 7: 141,412,555 (GRCm39) S1834P unknown Het
Necap1 C T 6: 122,864,328 (GRCm39) S270F possibly damaging Het
Piwil2 T C 14: 70,628,014 (GRCm39) M752V probably benign Het
Prune1 G A 3: 95,189,207 (GRCm39) probably null Het
Ptpro A G 6: 137,370,657 (GRCm39) E586G probably damaging Het
Rela T A 19: 5,697,290 (GRCm39) I499K probably damaging Het
Rpl31-ps17 C T 12: 54,748,397 (GRCm39) noncoding transcript Het
Scara5 T A 14: 66,000,196 (GRCm39) D455E probably benign Het
Slc2a4 G A 11: 69,834,148 (GRCm39) probably benign Het
Sntb2 G A 8: 107,718,239 (GRCm39) probably null Het
Sspo C T 6: 48,442,450 (GRCm39) R1982C probably damaging Het
Tsen34 G A 7: 3,698,097 (GRCm39) probably null Het
Ttc28 AC A 5: 111,371,924 (GRCm39) probably null Het
Ttn T C 2: 76,777,257 (GRCm39) M1382V probably benign Het
Utp18 G A 11: 93,776,273 (GRCm39) R71C probably benign Het
Xrn1 T A 9: 95,855,698 (GRCm39) probably benign Het
Yeats2 A G 16: 19,980,743 (GRCm39) K187R possibly damaging Het
Other mutations in Mslnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Mslnl APN 17 25,962,641 (GRCm39) unclassified probably benign
IGL01629:Mslnl APN 17 25,963,749 (GRCm39) missense possibly damaging 0.95
IGL02084:Mslnl APN 17 25,965,125 (GRCm39) missense probably benign 0.07
IGL02408:Mslnl APN 17 25,966,972 (GRCm39) missense possibly damaging 0.80
IGL02726:Mslnl APN 17 25,963,077 (GRCm39) critical splice donor site probably null
IGL03387:Mslnl APN 17 25,963,051 (GRCm39) missense probably benign 0.06
R0561:Mslnl UTSW 17 25,962,177 (GRCm39) nonsense probably null
R0881:Mslnl UTSW 17 25,961,939 (GRCm39) missense possibly damaging 0.82
R1295:Mslnl UTSW 17 25,962,214 (GRCm39) missense probably damaging 1.00
R1296:Mslnl UTSW 17 25,962,214 (GRCm39) missense probably damaging 1.00
R1582:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1629:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1630:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1631:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1632:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1794:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1850:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1866:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1876:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1914:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2166:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2241:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2243:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2247:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2282:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2284:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2852:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2867:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2867:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2877:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2878:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2919:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2920:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3026:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3405:Mslnl UTSW 17 25,965,155 (GRCm39) missense probably damaging 1.00
R3406:Mslnl UTSW 17 25,965,155 (GRCm39) missense probably damaging 1.00
R3411:Mslnl UTSW 17 25,963,491 (GRCm39) missense probably benign 0.05
R3434:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3546:Mslnl UTSW 17 25,963,943 (GRCm39) missense probably damaging 0.98
R3612:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3729:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3730:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3802:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3804:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3894:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3895:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4454:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4456:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4457:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4561:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4562:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4564:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4600:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4601:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4610:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4704:Mslnl UTSW 17 25,957,952 (GRCm39) missense possibly damaging 0.73
R5155:Mslnl UTSW 17 25,957,942 (GRCm39) nonsense probably null
R5257:Mslnl UTSW 17 25,965,139 (GRCm39) missense probably benign 0.00
R5456:Mslnl UTSW 17 25,962,133 (GRCm39) missense probably damaging 0.98
R5645:Mslnl UTSW 17 25,956,816 (GRCm39) missense possibly damaging 0.95
R6007:Mslnl UTSW 17 25,965,749 (GRCm39) missense probably benign 0.00
R6083:Mslnl UTSW 17 25,956,876 (GRCm39) missense possibly damaging 0.83
R6142:Mslnl UTSW 17 25,963,531 (GRCm39) missense probably damaging 1.00
R6761:Mslnl UTSW 17 25,965,047 (GRCm39) missense probably damaging 1.00
R7058:Mslnl UTSW 17 25,962,186 (GRCm39) missense probably benign 0.03
R7156:Mslnl UTSW 17 25,962,184 (GRCm39) missense probably benign 0.20
R7467:Mslnl UTSW 17 25,955,895 (GRCm39) start codon destroyed probably benign 0.33
R7687:Mslnl UTSW 17 25,962,157 (GRCm39) missense probably damaging 0.97
R7807:Mslnl UTSW 17 25,965,751 (GRCm39) missense probably benign 0.03
R8682:Mslnl UTSW 17 25,965,962 (GRCm39) missense probably benign
R8735:Mslnl UTSW 17 25,964,062 (GRCm39) missense probably benign 0.09
R8742:Mslnl UTSW 17 25,964,047 (GRCm39) missense probably damaging 1.00
R9208:Mslnl UTSW 17 25,961,694 (GRCm39) missense possibly damaging 0.94
R9264:Mslnl UTSW 17 25,961,506 (GRCm39) intron probably benign
RF007:Mslnl UTSW 17 25,962,202 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CCATCAGAAGGGAGGTTTGAAC -3'
(R):5'- ACAGGTCTGAAGCACTGAGC -3'

Sequencing Primer
(F):5'- TTTGAACCCAGGACTGAGGTGAC -3'
(R):5'- GCCCTGCCGAGACAGTAG -3'
Posted On 2015-07-21