Incidental Mutation 'R4455:Rela'
ID329170
Institutional Source Beutler Lab
Gene Symbol Rela
Ensembl Gene ENSMUSG00000024927
Gene Namev-rel reticuloendotheliosis viral oncogene homolog A (avian)
Synonymsp65, p65 NF kappaB
MMRRC Submission 041715-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4455 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location5637483-5648130 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5647262 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 499 (I499K)
Ref Sequence ENSEMBL: ENSMUSP00000025867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025867] [ENSMUST00000071857] [ENSMUST00000080824] [ENSMUST00000164304] [ENSMUST00000169854]
PDB Structure
STRUCTURE OF NF-KB P50 HOMODIMER BOUND TO A KB SITE [X-RAY DIFFRACTION]
IKAPPABALPHA/NF-KAPPAB COMPLEX [X-RAY DIFFRACTION]
X-ray crystal structure of the IkBb/NF-kB p65 homodimer complex [X-RAY DIFFRACTION]
Crystal structure of a NF-kB heterodimer bound to an IFNb-kB [X-RAY DIFFRACTION]
Crystal structure of a NF-kB heterodimer bound to the Ig/HIV-kB siti [X-RAY DIFFRACTION]
The kB DNA sequence from the HLV-LTR functions as an allosteric regulator of HIV transcription [X-RAY DIFFRACTION]
NF-kappaB p65 subunit dimerization domain homodimer [X-RAY DIFFRACTION]
NF-kappaB p65 subunit dimerization domain homodimer N202R mutation [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF AN IKBBETA/NF-KB P65 HOMODIMER COMPLEX [X-RAY DIFFRACTION]
A NOVEL DNA RECOGNITION MODE BY NF-KB P65 HOMODIMER [X-RAY DIFFRACTION]
>> 4 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000025867
AA Change: I499K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025867
Gene: ENSMUSG00000024927
AA Change: I499K

DomainStartEndE-ValueType
Pfam:RHD_DNA_bind 21 186 3.6e-72 PFAM
IPT 193 289 2.81e-22 SMART
low complexity region 377 389 N/A INTRINSIC
low complexity region 399 417 N/A INTRINSIC
PDB:2LWW|B 425 490 1e-37 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000071857
SMART Domains Protein: ENSMUSP00000073618
Gene: ENSMUSG00000056917

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 529 7.2e-64 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080824
SMART Domains Protein: ENSMUSP00000079637
Gene: ENSMUSG00000056917

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 535 4.4e-60 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164304
SMART Domains Protein: ENSMUSP00000128208
Gene: ENSMUSG00000056917

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 535 4.4e-60 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169854
SMART Domains Protein: ENSMUSP00000132345
Gene: ENSMUSG00000056917

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 535 4.4e-60 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Meta Mutation Damage Score 0.3033 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NF-kappa-B is a ubiquitous transcription factor involved in several biological processes. It is held in the cytoplasm in an inactive state by specific inhibitors. Upon degradation of the inhibitor, NF-kappa-B moves to the nucleus and activates transcription of specific genes. NF-kappa-B is composed of NFKB1 or NFKB2 bound to either REL, RELA, or RELB. The most abundant form of NF-kappa-B is NFKB1 complexed with the product of this gene, RELA. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice are embryonic lethal due to hepatic apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,397,196 H166R possibly damaging Het
Aktip T C 8: 91,124,851 E248G probably benign Het
Ankk1 A G 9: 49,418,066 V336A probably benign Het
Aoc1 T A 6: 48,905,467 D92E probably damaging Het
Arfgef2 T C 2: 166,894,715 I1769T probably benign Het
Arfgef3 A T 10: 18,607,675 S1434T probably benign Het
Baz1a C A 12: 54,911,368 V1033L probably benign Het
Bbs12 T C 3: 37,320,312 V418A probably damaging Het
Cacnb4 A G 2: 52,465,653 V214A probably damaging Het
Camk2d T C 3: 126,780,403 V153A probably damaging Het
Ccdc18 C T 5: 108,161,529 S330L possibly damaging Het
Cdh11 T C 8: 102,647,823 D500G probably benign Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Clca4a G A 3: 144,957,259 P610S probably damaging Het
Dctn1 T C 6: 83,195,049 L807P probably damaging Het
Dopey2 T C 16: 93,766,215 L869P probably damaging Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fam227b T A 2: 126,146,268 probably benign Het
Fam26f A T 10: 34,126,535 I184N probably damaging Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Grb10 T G 11: 11,967,665 Q72P possibly damaging Het
H3f3a G T 1: 180,803,103 R129S probably benign Het
Hfm1 T C 5: 106,886,508 probably null Het
Kansl1 T C 11: 104,424,358 T285A possibly damaging Het
Krtap16-1 A T 11: 99,985,733 C282S probably benign Het
Magi1 A G 6: 93,785,457 V89A probably damaging Het
Mllt1 A G 17: 56,919,965 Y71H probably damaging Het
Ms4a14 T A 19: 11,303,626 T523S possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Muc5b T C 7: 141,858,818 S1834P unknown Het
Necap1 C T 6: 122,887,369 S270F possibly damaging Het
Piwil2 T C 14: 70,390,565 M752V probably benign Het
Prune1 G A 3: 95,281,896 probably null Het
Ptpro A G 6: 137,393,659 E586G probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Scara5 T A 14: 65,762,747 D455E probably benign Het
Slc2a4 G A 11: 69,943,322 probably benign Het
Sntb2 G A 8: 106,991,607 probably null Het
Sspo C T 6: 48,465,516 R1982C probably damaging Het
Svs1 A T 6: 48,987,460 N134I possibly damaging Het
Tsen34 G A 7: 3,695,098 probably null Het
Ttc28 AC A 5: 111,224,058 probably null Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Utp18 G A 11: 93,885,447 R71C probably benign Het
Xrn1 T A 9: 95,973,645 probably benign Het
Yeats2 A G 16: 20,161,993 K187R possibly damaging Het
Other mutations in Rela
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01905:Rela APN 19 5645564 missense probably benign 0.00
IGL02060:Rela APN 19 5638600 missense probably damaging 1.00
IGL02550:Rela APN 19 5641506 missense possibly damaging 0.58
IGL03130:Rela APN 19 5639881 missense probably damaging 1.00
H8786:Rela UTSW 19 5647018 missense probably benign 0.00
R1597:Rela UTSW 19 5645331 missense probably damaging 0.99
R5322:Rela UTSW 19 5645380 missense possibly damaging 0.48
R5994:Rela UTSW 19 5647064 missense possibly damaging 0.59
R6006:Rela UTSW 19 5639939 missense probably damaging 1.00
R6301:Rela UTSW 19 5645410 splice site probably null
R6318:Rela UTSW 19 5646964 missense probably benign 0.01
R6556:Rela UTSW 19 5647338 missense probably damaging 1.00
R6646:Rela UTSW 19 5647104 missense probably damaging 0.98
R7697:Rela UTSW 19 5641602 missense probably damaging 1.00
Z1176:Rela UTSW 19 5641649 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTGCAGTTTGATGCTGATGAAG -3'
(R):5'- ATGTGTACGCACTTCGGGAAG -3'

Sequencing Primer
(F):5'- CTGATGAAGACTTGGGGGCC -3'
(R):5'- TGAAACCTGGTGCTCTGAGC -3'
Posted On2015-07-21