Incidental Mutation 'R4455:Ms4a14'
ID329171
Institutional Source Beutler Lab
Gene Symbol Ms4a14
Ensembl Gene ENSMUSG00000099398
Gene Namemembrane-spanning 4-domains, subfamily A, member 14
SynonymsLOC383435
MMRRC Submission 041715-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R4455 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location11301249-11314454 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 11303626 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 523 (T523S)
Ref Sequence ENSEMBL: ENSMUSP00000140996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000187467]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181137
Predicted Effect possibly damaging
Transcript: ENSMUST00000187467
AA Change: T523S

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140996
Gene: ENSMUSG00000099398
AA Change: T523S

DomainStartEndE-ValueType
Pfam:CD20 44 182 2.9e-27 PFAM
internal_repeat_2 356 466 2.78e-10 PROSPERO
internal_repeat_1 390 506 1.75e-17 PROSPERO
low complexity region 522 540 N/A INTRINSIC
low complexity region 625 640 N/A INTRINSIC
low complexity region 642 660 N/A INTRINSIC
internal_repeat_1 665 786 1.75e-17 PROSPERO
internal_repeat_2 700 811 2.78e-10 PROSPERO
low complexity region 911 936 N/A INTRINSIC
low complexity region 975 992 N/A INTRINSIC
low complexity region 1079 1092 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A G 9: 108,397,196 H166R possibly damaging Het
Aktip T C 8: 91,124,851 E248G probably benign Het
Ankk1 A G 9: 49,418,066 V336A probably benign Het
Aoc1 T A 6: 48,905,467 D92E probably damaging Het
Arfgef2 T C 2: 166,894,715 I1769T probably benign Het
Arfgef3 A T 10: 18,607,675 S1434T probably benign Het
Baz1a C A 12: 54,911,368 V1033L probably benign Het
Bbs12 T C 3: 37,320,312 V418A probably damaging Het
Cacnb4 A G 2: 52,465,653 V214A probably damaging Het
Camk2d T C 3: 126,780,403 V153A probably damaging Het
Ccdc18 C T 5: 108,161,529 S330L possibly damaging Het
Cdh11 T C 8: 102,647,823 D500G probably benign Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Clca4a G A 3: 144,957,259 P610S probably damaging Het
Dctn1 T C 6: 83,195,049 L807P probably damaging Het
Dopey2 T C 16: 93,766,215 L869P probably damaging Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fam227b T A 2: 126,146,268 probably benign Het
Fam26f A T 10: 34,126,535 I184N probably damaging Het
Fsip2 G T 2: 82,990,776 A5618S possibly damaging Het
Grb10 T G 11: 11,967,665 Q72P possibly damaging Het
H3f3a G T 1: 180,803,103 R129S probably benign Het
Hfm1 T C 5: 106,886,508 probably null Het
Kansl1 T C 11: 104,424,358 T285A possibly damaging Het
Krtap16-1 A T 11: 99,985,733 C282S probably benign Het
Magi1 A G 6: 93,785,457 V89A probably damaging Het
Mllt1 A G 17: 56,919,965 Y71H probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Muc5b T C 7: 141,858,818 S1834P unknown Het
Necap1 C T 6: 122,887,369 S270F possibly damaging Het
Piwil2 T C 14: 70,390,565 M752V probably benign Het
Prune1 G A 3: 95,281,896 probably null Het
Ptpro A G 6: 137,393,659 E586G probably damaging Het
Rela T A 19: 5,647,262 I499K probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Scara5 T A 14: 65,762,747 D455E probably benign Het
Slc2a4 G A 11: 69,943,322 probably benign Het
Sntb2 G A 8: 106,991,607 probably null Het
Sspo C T 6: 48,465,516 R1982C probably damaging Het
Svs1 A T 6: 48,987,460 N134I possibly damaging Het
Tsen34 G A 7: 3,695,098 probably null Het
Ttc28 AC A 5: 111,224,058 probably null Het
Ttn T C 2: 76,946,913 M1382V probably benign Het
Utp18 G A 11: 93,885,447 R71C probably benign Het
Xrn1 T A 9: 95,973,645 probably benign Het
Yeats2 A G 16: 20,161,993 K187R possibly damaging Het
Other mutations in Ms4a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Ms4a14 APN 19 11301619 missense possibly damaging 0.73
IGL03131:Ms4a14 APN 19 11307692 missense probably benign 0.01
IGL03136:Ms4a14 APN 19 11304411 missense possibly damaging 0.85
IGL03173:Ms4a14 APN 19 11304196 missense possibly damaging 0.86
IGL03210:Ms4a14 APN 19 11301961 missense possibly damaging 0.96
R0054:Ms4a14 UTSW 19 11303939 missense probably benign 0.00
R2895:Ms4a14 UTSW 19 11304231 missense possibly damaging 0.73
R4574:Ms4a14 UTSW 19 11303971 missense probably benign
R4804:Ms4a14 UTSW 19 11304040 missense possibly damaging 0.73
R4815:Ms4a14 UTSW 19 11314277 missense probably benign 0.00
R4854:Ms4a14 UTSW 19 11310369 missense possibly damaging 0.51
R4858:Ms4a14 UTSW 19 11301612 missense probably benign 0.33
R5002:Ms4a14 UTSW 19 11304289 missense probably benign
R5382:Ms4a14 UTSW 19 11303057 missense possibly damaging 0.70
R5580:Ms4a14 UTSW 19 11303226 missense probably benign 0.33
R5626:Ms4a14 UTSW 19 11304055 missense probably benign
R5767:Ms4a14 UTSW 19 11302027 missense probably benign 0.18
R5801:Ms4a14 UTSW 19 11301786 missense possibly damaging 0.86
R5801:Ms4a14 UTSW 19 11301882 missense possibly damaging 0.73
R5865:Ms4a14 UTSW 19 11304217 missense possibly damaging 0.73
R5919:Ms4a14 UTSW 19 11314297 missense possibly damaging 0.86
R6261:Ms4a14 UTSW 19 11304020 missense probably benign 0.33
R6585:Ms4a14 UTSW 19 11303645 missense unknown
R6974:Ms4a14 UTSW 19 11302135 missense probably benign
R7401:Ms4a14 UTSW 19 11302230 missense possibly damaging 0.72
R7445:Ms4a14 UTSW 19 11302972 missense probably benign 0.00
R7489:Ms4a14 UTSW 19 11302031 missense probably benign 0.07
R7524:Ms4a14 UTSW 19 11303836 missense unknown
R7532:Ms4a14 UTSW 19 11303959 missense possibly damaging 0.86
R7689:Ms4a14 UTSW 19 11302542 missense probably benign 0.33
R7732:Ms4a14 UTSW 19 11301683 missense probably benign
R7737:Ms4a14 UTSW 19 11302786 nonsense probably null
R7860:Ms4a14 UTSW 19 11302944 missense probably benign
R8098:Ms4a14 UTSW 19 11304615 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TGGAGTCACTTCAGATGGAGAC -3'
(R):5'- AAGAGACTCCATCCCAAGGG -3'

Sequencing Primer
(F):5'- GATGGAGACACTTGGAGT -3'
(R):5'- GGGACTCCATACCAAGATCTAC -3'
Posted On2015-07-21