Incidental Mutation 'R4456:Nckap5'
ID329174
Institutional Source Beutler Lab
Gene Symbol Nckap5
Ensembl Gene ENSMUSG00000049690
Gene NameNCK-associated protein 5
SynonymsE030049G20Rik, LOC380609, D130011D22Rik
MMRRC Submission 041716-MU
Accession Numbers

Genbank: NM_001081756, NM_172484, NM_176957

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4456 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location125913620-126830799 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 125914735 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027582] [ENSMUST00000057846] [ENSMUST00000094609] [ENSMUST00000094610] [ENSMUST00000112583] [ENSMUST00000159417] [ENSMUST00000159529] [ENSMUST00000161361] [ENSMUST00000161954] [ENSMUST00000162877] [ENSMUST00000162899]
Predicted Effect probably benign
Transcript: ENSMUST00000027582
SMART Domains Protein: ENSMUSP00000027582
Gene: ENSMUSG00000026344

DomainStartEndE-ValueType
LU 24 122 5.18e-2 SMART
low complexity region 126 142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057846
SMART Domains Protein: ENSMUSP00000062229
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
coiled coil region 108 186 N/A INTRINSIC
low complexity region 321 332 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 950 971 N/A INTRINSIC
low complexity region 1070 1085 N/A INTRINSIC
low complexity region 1181 1200 N/A INTRINSIC
Pfam:NCKAP5 1298 1602 1.8e-120 PFAM
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1757 1771 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094609
SMART Domains Protein: ENSMUSP00000092192
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
low complexity region 70 93 N/A INTRINSIC
Pfam:NCKAP5 113 364 3.6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094610
SMART Domains Protein: ENSMUSP00000092193
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
Pfam:NCKAP5 1 101 8.8e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112583
SMART Domains Protein: ENSMUSP00000108202
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
low complexity region 70 93 N/A INTRINSIC
coiled coil region 176 254 N/A INTRINSIC
low complexity region 301 324 N/A INTRINSIC
low complexity region 453 464 N/A INTRINSIC
low complexity region 887 903 N/A INTRINSIC
low complexity region 1082 1103 N/A INTRINSIC
low complexity region 1202 1217 N/A INTRINSIC
low complexity region 1313 1332 N/A INTRINSIC
Pfam:NCKAP5 1431 1733 5.3e-119 PFAM
low complexity region 1860 1874 N/A INTRINSIC
low complexity region 1889 1903 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159417
SMART Domains Protein: ENSMUSP00000125149
Gene: ENSMUSG00000026344

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LU 23 121 2.5e-4 SMART
low complexity region 125 140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159529
SMART Domains Protein: ENSMUSP00000123824
Gene: ENSMUSG00000026344

DomainStartEndE-ValueType
Blast:LU 1 69 4e-32 BLAST
low complexity region 73 89 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160736
Predicted Effect probably benign
Transcript: ENSMUST00000161361
Predicted Effect probably benign
Transcript: ENSMUST00000161954
SMART Domains Protein: ENSMUSP00000125624
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
coiled coil region 108 186 N/A INTRINSIC
low complexity region 233 256 N/A INTRINSIC
low complexity region 385 396 N/A INTRINSIC
low complexity region 819 835 N/A INTRINSIC
low complexity region 1014 1035 N/A INTRINSIC
low complexity region 1134 1149 N/A INTRINSIC
low complexity region 1245 1264 N/A INTRINSIC
Pfam:NCKAP5 1362 1666 2.1e-120 PFAM
low complexity region 1792 1806 N/A INTRINSIC
low complexity region 1821 1835 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162877
SMART Domains Protein: ENSMUSP00000124748
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
Pfam:NCKAP5 9 296 6e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191994
Predicted Effect probably benign
Transcript: ENSMUST00000162899
SMART Domains Protein: ENSMUSP00000125158
Gene: ENSMUSG00000026344

DomainStartEndE-ValueType
Blast:LU 1 69 4e-32 BLAST
low complexity region 73 89 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 93% (42/45)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,942,245 F1210L probably benign Het
Amfr C T 8: 93,984,940 A323T possibly damaging Het
Apob T A 12: 8,015,445 I4105N probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Cdc42ep1 A G 15: 78,849,891 E397G possibly damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Dnmt1 T C 9: 20,909,842 T1250A probably damaging Het
Dst A T 1: 34,190,719 K2642N probably benign Het
Emcn A T 3: 137,379,847 K69* probably null Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fbxo38 G T 18: 62,526,249 R326S probably damaging Het
Fcer1g A G 1: 171,234,239 S3P probably benign Het
Glp1r G T 17: 30,918,975 E127* probably null Het
Gnmt G T 17: 46,728,984 H56Q probably benign Het
Hectd4 C T 5: 121,308,271 T1513I possibly damaging Het
Hsd3b1 G A 3: 98,856,143 T48I probably benign Het
Kmt2c A T 5: 25,310,212 C2878S probably benign Het
Loxhd1 A G 18: 77,399,089 Y1290C probably damaging Het
Mkln1 A G 6: 31,426,772 Y76C probably damaging Het
Mri1 C A 8: 84,256,406 A129S probably benign Het
Mroh2b A T 15: 4,947,925 H1253L probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mthfsd C T 8: 121,105,765 V63I possibly damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Nbea A G 3: 55,643,784 V2653A probably benign Het
Notch4 G A 17: 34,583,833 V1378M probably damaging Het
Olfr643 A G 7: 104,059,300 S101P possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rasl12 A G 9: 65,398,584 K7R probably null Het
Rnf4 A G 5: 34,351,361 Y189C probably benign Het
Shroom3 A G 5: 92,940,999 H536R probably benign Het
Slc2a4 G A 11: 69,943,322 probably benign Het
Tbc1d5 A C 17: 50,782,341 S604A probably damaging Het
Tcp11l1 A T 2: 104,684,222 V400E probably damaging Het
Tom1l2 G T 11: 60,352,815 probably benign Het
Ttc28 AC A 5: 111,224,058 probably null Het
Txndc15 A G 13: 55,718,164 D147G possibly damaging Het
Other mutations in Nckap5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Nckap5 APN 1 126027152 missense probably damaging 0.99
IGL00956:Nckap5 APN 1 126025018 missense probably damaging 0.98
IGL01414:Nckap5 APN 1 126528713 missense probably damaging 1.00
IGL01482:Nckap5 APN 1 126023160 missense probably damaging 1.00
IGL01508:Nckap5 APN 1 126025572 missense probably damaging 0.96
IGL02071:Nckap5 APN 1 125981568 missense probably damaging 0.97
IGL02129:Nckap5 APN 1 126027695 nonsense probably null
IGL02821:Nckap5 APN 1 126027816 missense probably damaging 1.00
IGL03174:Nckap5 APN 1 125981646 missense probably damaging 1.00
F5493:Nckap5 UTSW 1 126025827 missense probably benign
G5030:Nckap5 UTSW 1 126025854 missense probably damaging 0.96
R0033:Nckap5 UTSW 1 125940242 intron probably benign
R0164:Nckap5 UTSW 1 126024407 missense possibly damaging 0.84
R0164:Nckap5 UTSW 1 126024407 missense possibly damaging 0.84
R0349:Nckap5 UTSW 1 126026434 missense probably benign
R0482:Nckap5 UTSW 1 126026365 missense possibly damaging 0.92
R0508:Nckap5 UTSW 1 125981384 splice site probably null
R0541:Nckap5 UTSW 1 126695722 missense possibly damaging 0.82
R0609:Nckap5 UTSW 1 126027288 nonsense probably null
R0701:Nckap5 UTSW 1 126025357 missense probably benign 0.06
R0782:Nckap5 UTSW 1 125981541 missense probably damaging 1.00
R1389:Nckap5 UTSW 1 126026710 missense probably damaging 0.99
R1401:Nckap5 UTSW 1 126014661 splice site probably benign
R1436:Nckap5 UTSW 1 126026061 missense possibly damaging 0.96
R1506:Nckap5 UTSW 1 126025913 nonsense probably null
R1528:Nckap5 UTSW 1 126024922 missense possibly damaging 0.68
R1942:Nckap5 UTSW 1 126024302 missense probably damaging 1.00
R1968:Nckap5 UTSW 1 126014630 missense probably damaging 0.99
R2055:Nckap5 UTSW 1 126026898 missense probably damaging 1.00
R2105:Nckap5 UTSW 1 126026518 missense probably damaging 1.00
R2214:Nckap5 UTSW 1 126025750 missense possibly damaging 0.77
R2311:Nckap5 UTSW 1 126528752 missense probably damaging 1.00
R2403:Nckap5 UTSW 1 126027409 missense probably benign 0.18
R2430:Nckap5 UTSW 1 125914757 missense probably damaging 0.99
R2914:Nckap5 UTSW 1 126026537 splice site probably null
R3782:Nckap5 UTSW 1 126025074 missense possibly damaging 0.93
R4133:Nckap5 UTSW 1 126222706 missense probably benign 0.13
R4249:Nckap5 UTSW 1 126027639 missense probably benign 0.01
R4448:Nckap5 UTSW 1 126025726 nonsense probably null
R4682:Nckap5 UTSW 1 126102542 critical splice donor site probably null
R4817:Nckap5 UTSW 1 126027215 missense possibly damaging 0.68
R4907:Nckap5 UTSW 1 126026152 missense possibly damaging 0.92
R4908:Nckap5 UTSW 1 126027587 missense probably damaging 1.00
R4924:Nckap5 UTSW 1 126027028 nonsense probably null
R4926:Nckap5 UTSW 1 126528641 intron probably benign
R5032:Nckap5 UTSW 1 125977049 missense possibly damaging 0.62
R5133:Nckap5 UTSW 1 126033960 missense probably benign 0.01
R5197:Nckap5 UTSW 1 126222673 missense possibly damaging 0.79
R5238:Nckap5 UTSW 1 126027724 missense probably damaging 0.96
R5257:Nckap5 UTSW 1 126024508 missense probably damaging 0.99
R5277:Nckap5 UTSW 1 126026540 nonsense probably null
R5512:Nckap5 UTSW 1 126027744 missense possibly damaging 0.63
R5700:Nckap5 UTSW 1 125976925 critical splice donor site probably null
R5789:Nckap5 UTSW 1 126027702 missense probably damaging 1.00
R6029:Nckap5 UTSW 1 126025786 missense possibly damaging 0.89
R6249:Nckap5 UTSW 1 126024930 missense probably benign
R6292:Nckap5 UTSW 1 125915015 missense probably damaging 0.99
R6521:Nckap5 UTSW 1 126382172 missense probably damaging 1.00
R6875:Nckap5 UTSW 1 126023194 missense probably benign 0.03
R7017:Nckap5 UTSW 1 126102661 missense probably damaging 1.00
R7018:Nckap5 UTSW 1 126025048 missense probably damaging 0.99
R7054:Nckap5 UTSW 1 126258712 splice site probably null
R7204:Nckap5 UTSW 1 126026367 missense probably benign
R7336:Nckap5 UTSW 1 126026049 missense probably benign 0.00
R7544:Nckap5 UTSW 1 126026211 missense possibly damaging 0.92
R7590:Nckap5 UTSW 1 126026533 missense probably benign 0.00
R7684:Nckap5 UTSW 1 126026857 missense probably benign 0.00
R7749:Nckap5 UTSW 1 126024646 missense probably damaging 1.00
R7773:Nckap5 UTSW 1 126026844 missense probably benign 0.00
R7813:Nckap5 UTSW 1 126025426 missense probably benign 0.10
R7970:Nckap5 UTSW 1 126025021 nonsense probably null
R7992:Nckap5 UTSW 1 126026810 missense probably damaging 0.99
R8278:Nckap5 UTSW 1 126027772 missense probably damaging 1.00
R8373:Nckap5 UTSW 1 126026295 missense probably benign 0.02
R8414:Nckap5 UTSW 1 126014620 missense probably damaging 1.00
Z1088:Nckap5 UTSW 1 126024832 missense possibly damaging 0.76
Z1176:Nckap5 UTSW 1 126528681 critical splice donor site probably null
Z1177:Nckap5 UTSW 1 126222659 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCGTTTCAAGAGCATGGCG -3'
(R):5'- TCCAAGTGAGGTTGAAGGAC -3'

Sequencing Primer
(F):5'- TTTCAAGAGCATGGCGCCAAC -3'
(R):5'- TCCAAGTGAGGTTGAAGGACAAAAG -3'
Posted On2015-07-21