Incidental Mutation 'R4456:Txndc15'
ID329201
Institutional Source Beutler Lab
Gene Symbol Txndc15
Ensembl Gene ENSMUSG00000021497
Gene Namethioredoxin domain containing 15
Synonyms
MMRRC Submission 041716-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R4456 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location55714650-55726227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55718164 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 147 (D147G)
Ref Sequence ENSEMBL: ENSMUSP00000021959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021959]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021959
AA Change: D147G

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021959
Gene: ENSMUSG00000021497
AA Change: D147G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Thioredoxin 174 278 8.6e-11 PFAM
transmembrane domain 305 324 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223649
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 93% (42/45)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,942,245 F1210L probably benign Het
Amfr C T 8: 93,984,940 A323T possibly damaging Het
Apob T A 12: 8,015,445 I4105N probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Cdc42ep1 A G 15: 78,849,891 E397G possibly damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Dnmt1 T C 9: 20,909,842 T1250A probably damaging Het
Dst A T 1: 34,190,719 K2642N probably benign Het
Emcn A T 3: 137,379,847 K69* probably null Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fbxo38 G T 18: 62,526,249 R326S probably damaging Het
Fcer1g A G 1: 171,234,239 S3P probably benign Het
Glp1r G T 17: 30,918,975 E127* probably null Het
Gnmt G T 17: 46,728,984 H56Q probably benign Het
Hectd4 C T 5: 121,308,271 T1513I possibly damaging Het
Hsd3b1 G A 3: 98,856,143 T48I probably benign Het
Kmt2c A T 5: 25,310,212 C2878S probably benign Het
Loxhd1 A G 18: 77,399,089 Y1290C probably damaging Het
Mkln1 A G 6: 31,426,772 Y76C probably damaging Het
Mri1 C A 8: 84,256,406 A129S probably benign Het
Mroh2b A T 15: 4,947,925 H1253L probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mthfsd C T 8: 121,105,765 V63I possibly damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Nbea A G 3: 55,643,784 V2653A probably benign Het
Nckap5 A T 1: 125,914,735 probably benign Het
Notch4 G A 17: 34,583,833 V1378M probably damaging Het
Olfr643 A G 7: 104,059,300 S101P possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rasl12 A G 9: 65,398,584 K7R probably null Het
Rnf4 A G 5: 34,351,361 Y189C probably benign Het
Shroom3 A G 5: 92,940,999 H536R probably benign Het
Slc2a4 G A 11: 69,943,322 probably benign Het
Tbc1d5 A C 17: 50,782,341 S604A probably damaging Het
Tcp11l1 A T 2: 104,684,222 V400E probably damaging Het
Tom1l2 G T 11: 60,352,815 probably benign Het
Ttc28 AC A 5: 111,224,058 probably null Het
Other mutations in Txndc15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Txndc15 APN 13 55725675 missense probably damaging 1.00
IGL01634:Txndc15 APN 13 55721625 missense probably damaging 0.99
PIT4791001:Txndc15 UTSW 13 55721694 missense probably benign 0.39
R0309:Txndc15 UTSW 13 55724582 missense probably damaging 1.00
R0480:Txndc15 UTSW 13 55724623 missense possibly damaging 0.91
R1473:Txndc15 UTSW 13 55721574 splice site probably benign
R1856:Txndc15 UTSW 13 55718062 missense possibly damaging 0.80
R4945:Txndc15 UTSW 13 55718165 missense probably benign 0.01
R5159:Txndc15 UTSW 13 55717921 missense probably benign
R5376:Txndc15 UTSW 13 55718219 missense probably damaging 1.00
R5776:Txndc15 UTSW 13 55718107 missense probably benign 0.01
R7365:Txndc15 UTSW 13 55714788 missense unknown
R7392:Txndc15 UTSW 13 55721586 missense probably damaging 1.00
R7557:Txndc15 UTSW 13 55717954 missense probably benign 0.05
R7679:Txndc15 UTSW 13 55725808 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCATGAAGAGGAGGTTGCTC -3'
(R):5'- CATCCATCCGAAAGCTGATGAG -3'

Sequencing Primer
(F):5'- AGGAGGTTGCTCAGGACCATC -3'
(R):5'- CCATCCGAAAGCTGATGAGTATTAG -3'
Posted On2015-07-21