Mutagenetix > Incidental Mutations

Incidental Mutation 'R4456:Mroh2b'

329203

Institutional Source

Beutler Lab

Gene Symbol

Mroh2b

Ensembl Gene

ENSMUSG00000022155

Gene Name

maestro heat-like repeat family member 2B

Synonyms

4930455B06Rik, Heatr7b2

MMRRC Submission

041716-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.128) question?

Stock #

R4456 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4898737-4962205 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 4947925 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 1253 (H1253L)

Ref Sequence

ENSEMBL: ENSMUSP00000036148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045736]

AlphaFold

Q7M6Y6

Predicted Effect

probably benign
Transcript: ENSMUST00000045736
AA Change: H1253L

PolyPhen 2 Score 0.212 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: H1253L

Domain	Start	End	E-Value	Type
low complexity region	124	135	N/A	INTRINSIC
low complexity region	824	842	N/A	INTRINSIC
SCOP:d1gw5a_	937	1443	7e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226849

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228458

Meta Mutation Damage Score

0.1574

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

93% (42/45)

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	A	G	11: 109,942,245	F1210L	probably benign	Het
Amfr	C	T	8: 93,984,940	A323T	possibly damaging	Het
Apob	T	A	12: 8,015,445	I4105N	probably damaging	Het
Bahd1	C	T	2: 118,916,406	P169S	probably damaging	Het
Cdc42ep1	A	G	15: 78,849,891	E397G	possibly damaging	Het
Cdkn2d	C	G	9: 21,290,889	V21L	probably benign	Het
Dnmt1	T	C	9: 20,909,842	T1250A	probably damaging	Het
Dst	A	T	1: 34,190,719	K2642N	probably benign	Het
Emcn	A	T	3: 137,379,847	K69*	probably null	Het
Eya1	C	T	1: 14,183,196	V519M	probably damaging	Het
Fbxo38	G	T	18: 62,526,249	R326S	probably damaging	Het
Fcer1g	A	G	1: 171,234,239	S3P	probably benign	Het
Glp1r	G	T	17: 30,918,975	E127*	probably null	Het
Gnmt	G	T	17: 46,728,984	H56Q	probably benign	Het
Hectd4	C	T	5: 121,308,271	T1513I	possibly damaging	Het
Hsd3b1	G	A	3: 98,856,143	T48I	probably benign	Het
Kmt2c	A	T	5: 25,310,212	C2878S	probably benign	Het
Loxhd1	A	G	18: 77,399,089	Y1290C	probably damaging	Het
Mkln1	A	G	6: 31,426,772	Y76C	probably damaging	Het
Mri1	C	A	8: 84,256,406	A129S	probably benign	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Mthfsd	C	T	8: 121,105,765	V63I	possibly damaging	Het
Naip2	T	A	13: 100,154,911	H1173L	probably benign	Het
Nbea	A	G	3: 55,643,784	V2653A	probably benign	Het
Nckap5	A	T	1: 125,914,735		probably benign	Het
Notch4	G	A	17: 34,583,833	V1378M	probably damaging	Het
Olfr643	A	G	7: 104,059,300	S101P	possibly damaging	Het
Rab36	G	A	10: 75,044,496	V63I	probably damaging	Het
Rasl12	A	G	9: 65,398,584	K7R	probably null	Het
Rnf4	A	G	5: 34,351,361	Y189C	probably benign	Het
Shroom3	A	G	5: 92,940,999	H536R	probably benign	Het
Slc2a4	G	A	11: 69,943,322		probably benign	Het
Tbc1d5	A	C	17: 50,782,341	S604A	probably damaging	Het
Tcp11l1	A	T	2: 104,684,222	V400E	probably damaging	Het
Tom1l2	G	T	11: 60,352,815		probably benign	Het
Ttc28	AC	A	5: 111,224,058		probably null	Het
Txndc15	A	G	13: 55,718,164	D147G	possibly damaging	Het

Other mutations in Mroh2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Mroh2b	APN	15	4899197	missense	probably benign
IGL00507:Mroh2b	APN	15	4962127	missense	probably damaging	1.00
IGL00548:Mroh2b	APN	15	4931316	missense	probably benign	0.35
IGL00902:Mroh2b	APN	15	4915222	missense	probably damaging	1.00
IGL00944:Mroh2b	APN	15	4951127	splice site	probably benign
IGL00954:Mroh2b	APN	15	4903054	missense	probably damaging	0.99
IGL01015:Mroh2b	APN	15	4941542	missense	probably damaging	1.00
IGL01134:Mroh2b	APN	15	4915152	missense	probably benign	0.00
IGL01337:Mroh2b	APN	15	4905024	missense	probably benign	0.38
IGL01780:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL01919:Mroh2b	APN	15	4923688	missense	probably benign	0.10
IGL02069:Mroh2b	APN	15	4904324	splice site	probably benign
IGL02146:Mroh2b	APN	15	4951294	splice site	probably null
IGL02221:Mroh2b	APN	15	4923641	missense	probably damaging	1.00
IGL02281:Mroh2b	APN	15	4952263	missense	probably benign	0.04
IGL02350:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02357:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02401:Mroh2b	APN	15	4900501	missense	possibly damaging	0.71
IGL02427:Mroh2b	APN	15	4951560	splice site	probably benign
IGL02432:Mroh2b	APN	15	4914186	missense	probably benign
IGL02582:Mroh2b	APN	15	4908515	missense	probably damaging	0.98
IGL02632:Mroh2b	APN	15	4931101	missense	probably damaging	0.99
IGL02741:Mroh2b	APN	15	4905632	missense	probably benign
IGL02811:Mroh2b	APN	15	4915236	missense	possibly damaging	0.55
IGL02826:Mroh2b	APN	15	4962148	missense	probably damaging	0.99
IGL03412:Mroh2b	APN	15	4944372	missense	probably benign	0.14
PIT4468001:Mroh2b	UTSW	15	4912812	missense	probably damaging	1.00
R0024:Mroh2b	UTSW	15	4925627	missense	probably damaging	1.00
R0333:Mroh2b	UTSW	15	4931118	missense	probably damaging	1.00
R0433:Mroh2b	UTSW	15	4941634	missense	probably benign	0.01
R0530:Mroh2b	UTSW	15	4934395	missense	probably damaging	0.97
R1411:Mroh2b	UTSW	15	4918317	missense	probably damaging	1.00
R1457:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1472:Mroh2b	UTSW	15	4948655	missense	probably benign	0.00
R1525:Mroh2b	UTSW	15	4951130	splice site	probably null
R1584:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1605:Mroh2b	UTSW	15	4945090	missense	probably benign	0.08
R1657:Mroh2b	UTSW	15	4931043	nonsense	probably null
R1671:Mroh2b	UTSW	15	4951294	splice site	probably null
R1698:Mroh2b	UTSW	15	4914140	missense	probably benign	0.02
R2002:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R2005:Mroh2b	UTSW	15	4917158	missense	probably damaging	1.00
R2077:Mroh2b	UTSW	15	4944966	missense	probably damaging	1.00
R2179:Mroh2b	UTSW	15	4921446	critical splice donor site	probably null
R2183:Mroh2b	UTSW	15	4918225	splice site	probably null
R3713:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3714:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3747:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3748:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3749:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3750:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3792:Mroh2b	UTSW	15	4923620	missense	probably damaging	1.00
R3872:Mroh2b	UTSW	15	4925061	nonsense	probably null
R4021:Mroh2b	UTSW	15	4925100	missense	possibly damaging	0.75
R4329:Mroh2b	UTSW	15	4931379	missense	probably damaging	0.99
R4592:Mroh2b	UTSW	15	4918290	missense	probably damaging	1.00
R4836:Mroh2b	UTSW	15	4904270	missense	probably damaging	1.00
R5050:Mroh2b	UTSW	15	4900450	missense	possibly damaging	0.82
R5230:Mroh2b	UTSW	15	4941522	missense	probably benign	0.07
R5342:Mroh2b	UTSW	15	4914133	nonsense	probably null
R5353:Mroh2b	UTSW	15	4917178	missense	probably damaging	1.00
R5368:Mroh2b	UTSW	15	4905572	missense	probably damaging	1.00
R5424:Mroh2b	UTSW	15	4941612	missense	probably damaging	0.98
R5484:Mroh2b	UTSW	15	4908981	missense	possibly damaging	0.92
R5999:Mroh2b	UTSW	15	4912884	splice site	probably null
R6046:Mroh2b	UTSW	15	4951281	missense	probably benign	0.01
R6081:Mroh2b	UTSW	15	4944377	missense	probably damaging	1.00
R6162:Mroh2b	UTSW	15	4915225	missense	probably damaging	1.00
R6165:Mroh2b	UTSW	15	4918350	missense	probably benign	0.23
R6240:Mroh2b	UTSW	15	4934644	missense	probably benign	0.38
R6487:Mroh2b	UTSW	15	4947239	missense	probably damaging	1.00
R6539:Mroh2b	UTSW	15	4905574	missense	probably damaging	1.00
R6616:Mroh2b	UTSW	15	4953282	missense	probably benign	0.36
R6663:Mroh2b	UTSW	15	4947935	missense	probably benign	0.21
R6820:Mroh2b	UTSW	15	4953274	missense	probably damaging	1.00
R6900:Mroh2b	UTSW	15	4908987	missense	probably benign	0.00
R6990:Mroh2b	UTSW	15	4912802	missense	possibly damaging	0.55
R7067:Mroh2b	UTSW	15	4900504	missense	probably benign	0.35
R7092:Mroh2b	UTSW	15	4934678	missense	possibly damaging	0.92
R7102:Mroh2b	UTSW	15	4948003	missense	probably benign	0.06
R7264:Mroh2b	UTSW	15	4921362	missense	possibly damaging	0.81
R7436:Mroh2b	UTSW	15	4941554	missense	probably benign	0.21
R7462:Mroh2b	UTSW	15	4908627	missense	probably damaging	1.00
R7529:Mroh2b	UTSW	15	4949009	missense	probably damaging	1.00
R7575:Mroh2b	UTSW	15	4934605	missense	probably damaging	1.00
R7579:Mroh2b	UTSW	15	4931061	missense	probably benign	0.09
R7605:Mroh2b	UTSW	15	4945023	missense	probably damaging	1.00
R7624:Mroh2b	UTSW	15	4917131	missense	probably damaging	1.00
R7797:Mroh2b	UTSW	15	4949105	missense	probably benign	0.36
R7848:Mroh2b	UTSW	15	4938379	nonsense	probably null
R7952:Mroh2b	UTSW	15	4951211	missense	probably damaging	1.00
R7995:Mroh2b	UTSW	15	4921357	nonsense	probably null
R8088:Mroh2b	UTSW	15	4900503	missense	possibly damaging	0.57
R8207:Mroh2b	UTSW	15	4938410	missense	possibly damaging	0.95
R8242:Mroh2b	UTSW	15	4909040	missense	probably benign	0.04
R8248:Mroh2b	UTSW	15	4931104	missense	probably benign	0.40
R8258:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8259:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8304:Mroh2b	UTSW	15	4925637	missense	probably damaging	0.99
R8316:Mroh2b	UTSW	15	4951264	nonsense	probably null
R8345:Mroh2b	UTSW	15	4944326	missense	probably benign	0.09
R8507:Mroh2b	UTSW	15	4949090	missense	probably damaging	1.00
R8728:Mroh2b	UTSW	15	4905640	missense	probably damaging	1.00
R8747:Mroh2b	UTSW	15	4935300	missense	probably damaging	0.99
R8798:Mroh2b	UTSW	15	4948709	missense	probably damaging	1.00
R8814:Mroh2b	UTSW	15	4941625	missense	possibly damaging	0.61
R8856:Mroh2b	UTSW	15	4931028	nonsense	probably null
R8910:Mroh2b	UTSW	15	4931373	missense	probably benign	0.01
R8913:Mroh2b	UTSW	15	4917528	intron	probably benign
R8941:Mroh2b	UTSW	15	4962124	missense	possibly damaging	0.86
R9014:Mroh2b	UTSW	15	4899188	start codon destroyed	probably null	0.95
R9086:Mroh2b	UTSW	15	4953272	critical splice acceptor site	probably null
R9101:Mroh2b	UTSW	15	4900453	missense	probably benign	0.20
R9118:Mroh2b	UTSW	15	4962091	missense	possibly damaging	0.86
R9393:Mroh2b	UTSW	15	4951184	missense	probably benign
R9429:Mroh2b	UTSW	15	4934425	missense	probably damaging	1.00
R9431:Mroh2b	UTSW	15	4934470	missense	probably damaging	1.00
R9443:Mroh2b	UTSW	15	4944339	missense	probably damaging	1.00
R9447:Mroh2b	UTSW	15	4931341	missense	probably damaging	1.00
X0067:Mroh2b	UTSW	15	4951591	missense	possibly damaging	0.90
Z1177:Mroh2b	UTSW	15	4905005	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCTTGAAAACCCTGTAAATACAC -3'
(R):5'- GCTCCAGGCATCACTAAGCTAC -3'

Sequencing Primer
(F):5'- ATACAGTCCCTCATGTTGTCAGGAC -3'
(R):5'- CAGGCATCACTAAGCTACATGAGG -3'

Posted On

2015-07-21