Incidental Mutation 'R4456:Cdc42ep1'
ID 329204
Institutional Source Beutler Lab
Gene Symbol Cdc42ep1
Ensembl Gene ENSMUSG00000049521
Gene Name CDC42 effector protein (Rho GTPase binding) 1
Synonyms MSE55, 1810058K22Rik, Borg5, CEP1
MMRRC Submission 041716-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock # R4456 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 78842624-78850897 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 78849891 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 397 (E397G)
Ref Sequence ENSEMBL: ENSMUSP00000060930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044584] [ENSMUST00000059619]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000044584
SMART Domains Protein: ENSMUSP00000036598
Gene: ENSMUSG00000043501

DomainStartEndE-ValueType
GLECT 5 130 1.56e-47 SMART
Gal-bind_lectin 8 129 1.44e-43 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000059619
AA Change: E397G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000060930
Gene: ENSMUSG00000049521
AA Change: E397G

DomainStartEndE-ValueType
PBD 38 72 2.55e-6 SMART
low complexity region 89 98 N/A INTRINSIC
Pfam:BORG_CEP 115 232 2.5e-21 PFAM
low complexity region 234 266 N/A INTRINSIC
low complexity region 272 291 N/A INTRINSIC
low complexity region 330 347 N/A INTRINSIC
low complexity region 377 391 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
Meta Mutation Damage Score 0.0899 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 93% (42/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CDC42 is a member of the Rho GTPase family that regulates multiple cellular activities, including actin polymerization. The protein encoded by this gene is a CDC42 binding protein that mediates actin cytoskeleton reorganization at the plasma membrane. This protein is secreted and is primarily found in bone marrow. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,942,245 F1210L probably benign Het
Amfr C T 8: 93,984,940 A323T possibly damaging Het
Apob T A 12: 8,015,445 I4105N probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Cdkn2d C G 9: 21,290,889 V21L probably benign Het
Dnmt1 T C 9: 20,909,842 T1250A probably damaging Het
Dst A T 1: 34,190,719 K2642N probably benign Het
Emcn A T 3: 137,379,847 K69* probably null Het
Eya1 C T 1: 14,183,196 V519M probably damaging Het
Fbxo38 G T 18: 62,526,249 R326S probably damaging Het
Fcer1g A G 1: 171,234,239 S3P probably benign Het
Glp1r G T 17: 30,918,975 E127* probably null Het
Gnmt G T 17: 46,728,984 H56Q probably benign Het
Hectd4 C T 5: 121,308,271 T1513I possibly damaging Het
Hsd3b1 G A 3: 98,856,143 T48I probably benign Het
Kmt2c A T 5: 25,310,212 C2878S probably benign Het
Loxhd1 A G 18: 77,399,089 Y1290C probably damaging Het
Mkln1 A G 6: 31,426,772 Y76C probably damaging Het
Mri1 C A 8: 84,256,406 A129S probably benign Het
Mroh2b A T 15: 4,947,925 H1253L probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mthfsd C T 8: 121,105,765 V63I possibly damaging Het
Naip2 T A 13: 100,154,911 H1173L probably benign Het
Nbea A G 3: 55,643,784 V2653A probably benign Het
Nckap5 A T 1: 125,914,735 probably benign Het
Notch4 G A 17: 34,583,833 V1378M probably damaging Het
Olfr643 A G 7: 104,059,300 S101P possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rasl12 A G 9: 65,398,584 K7R probably null Het
Rnf4 A G 5: 34,351,361 Y189C probably benign Het
Shroom3 A G 5: 92,940,999 H536R probably benign Het
Slc2a4 G A 11: 69,943,322 probably benign Het
Tbc1d5 A C 17: 50,782,341 S604A probably damaging Het
Tcp11l1 A T 2: 104,684,222 V400E probably damaging Het
Tom1l2 G T 11: 60,352,815 probably benign Het
Ttc28 AC A 5: 111,224,058 probably null Het
Txndc15 A G 13: 55,718,164 D147G possibly damaging Het
Other mutations in Cdc42ep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4378001:Cdc42ep1 UTSW 15 78849680 missense possibly damaging 0.83
R2111:Cdc42ep1 UTSW 15 78847492 missense probably damaging 1.00
R3689:Cdc42ep1 UTSW 15 78847429 missense probably benign 0.03
R3690:Cdc42ep1 UTSW 15 78847429 missense probably benign 0.03
R5714:Cdc42ep1 UTSW 15 78849777 missense possibly damaging 0.93
R6374:Cdc42ep1 UTSW 15 78847449 missense probably damaging 1.00
R7944:Cdc42ep1 UTSW 15 78847773 missense possibly damaging 0.94
R7945:Cdc42ep1 UTSW 15 78847773 missense possibly damaging 0.94
R7995:Cdc42ep1 UTSW 15 78847496 missense probably damaging 1.00
R8010:Cdc42ep1 UTSW 15 78847799 missense possibly damaging 0.62
R9293:Cdc42ep1 UTSW 15 78849825 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTCCAACATGGCCTTTGAC -3'
(R):5'- CCTTGCATAGACCAGGAAGG -3'

Sequencing Primer
(F):5'- CCTTTGACAGGCATGGAGC -3'
(R):5'- CCTTGCATAGACCAGGAAGGATCTG -3'
Posted On 2015-07-21