Incidental Mutation 'R4467:Elf3'
ID 329213
Institutional Source Beutler Lab
Gene Symbol Elf3
Ensembl Gene ENSMUSG00000003051
Gene Name E74-like factor 3
Synonyms ESX, jen, ESE-1
MMRRC Submission 041724-MU
Accession Numbers

Ncbi RefSeq: NM_001163131.1, NM_007921.3; MGI:1101781
Is this an essential gene? Probably essential (E-score: 0.913) question?
Stock # R4467 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 135253575-135258568 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 135256844 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 138 (I138T)
Ref Sequence ENSEMBL: ENSMUSP00000139769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003135] [ENSMUST00000185752]
AlphaFold Q3UPW2
Predicted Effect possibly damaging
Transcript: ENSMUST00000003135
AA Change: I158T

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000003135
Gene: ENSMUSG00000003051
AA Change: I158T

DomainStartEndE-ValueType
SAM_PNT 67 151 6.32e-30 SMART
low complexity region 230 241 N/A INTRINSIC
AT_hook 264 276 1.29e0 SMART
ETS 292 379 6.11e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180981
Predicted Effect probably damaging
Transcript: ENSMUST00000185752
AA Change: I138T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139769
Gene: ENSMUSG00000003051
AA Change: I138T

DomainStartEndE-ValueType
SAM_PNT 47 131 1.36e-29 SMART
low complexity region 210 221 N/A INTRINSIC
AT_hook 244 256 1.29e0 SMART
ETS 272 359 6.11e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188895
Meta Mutation Damage Score 0.1131 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 98% (52/53)
MGI Phenotype Strain: 2662485
Lethality: D11-D21
PHENOTYPE: About one third of mice homozygous for a reporter allele die at E11.5; over half of those born develop a wasted phenotype, lethargy and watery diarrhea and die during the first few weeks of life exhibiting dysmorphogenesis and altered differentiation of small intestinal epithelium. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
4930402H24Rik A G 2: 130,767,647 I372T probably damaging Het
Atg4a-ps A G 3: 103,645,855 Y57H probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bms1 G A 6: 118,383,847 T1220I probably damaging Het
Brat1 T C 5: 140,705,071 probably benign Het
Casc1 A T 6: 145,183,218 probably null Het
Cds2 T A 2: 132,294,446 Y39* probably null Het
Chrnd T A 1: 87,197,377 L384Q probably damaging Het
Cpa3 A T 3: 20,228,817 Y155* probably null Het
Crlf1 G A 8: 70,500,956 W260* probably null Het
Cux1 C G 5: 136,312,722 E605D probably damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Dmtf1 T C 5: 9,136,085 N167S probably damaging Het
Dtx2 T A 5: 136,012,076 W112R probably damaging Het
F11 T A 8: 45,241,474 I617F probably damaging Het
Fdps A T 3: 89,100,786 D8E possibly damaging Het
Fzd10 C A 5: 128,601,276 T20K probably benign Het
Gm9978 T A 10: 78,486,916 noncoding transcript Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Has1 C T 17: 17,843,995 V461M probably benign Het
Hdac3 C T 18: 37,952,513 G80D probably benign Het
Klk12 A T 7: 43,773,383 R245W probably damaging Het
Lamp5 A G 2: 136,059,020 I47V probably damaging Het
Olfr786 T C 10: 129,437,064 I84T probably benign Het
Ovgp1 A G 3: 105,977,711 D122G probably benign Het
Piezo1 T C 8: 122,486,396 E1875G probably benign Het
Pih1d1 A G 7: 45,158,497 M132V possibly damaging Het
Pon2 C T 6: 5,267,021 A241T probably benign Het
Prkce A G 17: 86,619,911 I538V possibly damaging Het
Rab36 C T 10: 75,052,043 R249* probably null Het
Rps6kl1 C T 12: 85,147,808 A110T probably damaging Het
Rsad1 T C 11: 94,544,530 T244A probably benign Het
Slc22a7 T C 17: 46,432,510 I532V probably benign Het
Slc2a7 T C 4: 150,163,274 V377A possibly damaging Het
Slx4 A G 16: 3,989,055 V508A possibly damaging Het
Stag2 A G X: 42,233,872 S400G probably benign Het
Stat6 T G 10: 127,651,228 I201M probably damaging Het
Stim2 T C 5: 54,116,194 probably null Het
Tbc1d9 A G 8: 83,210,478 Y63C probably damaging Het
Tctn2 T C 5: 124,620,189 noncoding transcript Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ubr5 T A 15: 38,004,336 T1282S probably damaging Het
Ufl1 A T 4: 25,254,806 I550N probably damaging Het
Uty A G Y: 1,158,372 V557A possibly damaging Het
Vmn1r54 T C 6: 90,269,271 S56P probably damaging Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Elf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02141:Elf3 APN 1 135257707 missense possibly damaging 0.94
IGL02470:Elf3 APN 1 135255012 missense probably damaging 1.00
IGL03018:Elf3 APN 1 135256065 missense possibly damaging 0.62
IGL03252:Elf3 APN 1 135254953 missense probably damaging 1.00
P0026:Elf3 UTSW 1 135255973 critical splice donor site probably null
R0087:Elf3 UTSW 1 135257137 missense probably damaging 1.00
R1842:Elf3 UTSW 1 135256793 missense possibly damaging 0.65
R1897:Elf3 UTSW 1 135257137 missense probably damaging 1.00
R2081:Elf3 UTSW 1 135257076 missense probably benign 0.12
R4049:Elf3 UTSW 1 135254277 missense probably benign 0.21
R4630:Elf3 UTSW 1 135256740 intron probably benign
R4715:Elf3 UTSW 1 135257752 missense probably damaging 1.00
R4923:Elf3 UTSW 1 135256735 intron probably benign
R5226:Elf3 UTSW 1 135257239 missense probably benign 0.07
R5422:Elf3 UTSW 1 135255040 missense probably damaging 0.98
R5706:Elf3 UTSW 1 135256482 missense probably benign 0.01
R7115:Elf3 UTSW 1 135257118 missense probably damaging 1.00
R7644:Elf3 UTSW 1 135256506 missense possibly damaging 0.89
R7855:Elf3 UTSW 1 135254352 missense probably damaging 1.00
R7940:Elf3 UTSW 1 135257128 missense probably damaging 1.00
R8315:Elf3 UTSW 1 135256576 missense probably benign 0.00
R8723:Elf3 UTSW 1 135257647 missense possibly damaging 0.95
R8724:Elf3 UTSW 1 135254360 missense probably damaging 1.00
R8906:Elf3 UTSW 1 135254940 missense probably damaging 1.00
R8960:Elf3 UTSW 1 135255075 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGAGAGGCCCAGGATACC -3'
(R):5'- TCGGGACCTCAGTAAGTCTAGG -3'

Sequencing Primer
(F):5'- TCCAGGGACCACAGAAATGACTATG -3'
(R):5'- ACCTCAGTAAGTCTAGGCTGGG -3'
Posted On 2015-07-21