Mutagenetix > Incidental Mutations

Incidental Mutation 'R4467:Elf3'

329213

Institutional Source

Beutler Lab

Gene Symbol

Elf3

Ensembl Gene

ENSMUSG00000003051

Gene Name

E74-like factor 3

Synonyms

ESX, jen, ESE-1

MMRRC Submission

041724-MU

Accession Numbers

Ncbi RefSeq: NM_001163131.1, NM_007921.3; MGI:1101781

Is this an essential gene?

Probably essential (E-score: 0.822) question?

Stock #

R4467 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

135253575-135258568 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 135256844 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 138 (I138T)

Ref Sequence

ENSEMBL: ENSMUSP00000139769 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003135] [ENSMUST00000185752]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000003135
AA Change: I158T

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000003135
Gene: ENSMUSG00000003051
AA Change: I158T

Domain	Start	End	E-Value	Type
SAM_PNT	67	151	6.32e-30	SMART
low complexity region	230	241	N/A	INTRINSIC
AT_hook	264	276	1.29e0	SMART
ETS	292	379	6.11e-49	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180981

Predicted Effect

probably damaging
Transcript: ENSMUST00000185752
AA Change: I138T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000139769
Gene: ENSMUSG00000003051
AA Change: I138T

Domain	Start	End	E-Value	Type
SAM_PNT	47	131	1.36e-29	SMART
low complexity region	210	221	N/A	INTRINSIC
AT_hook	244	256	1.29e0	SMART
ETS	272	359	6.11e-49	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188895

Meta Mutation Damage Score

0.1131

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 95.0%

Validation Efficiency

98% (52/53)

MGI Phenotype

Strain: 2662485
Lethality: D11-D21
PHENOTYPE: About one third of mice homozygous for a reporter allele die at E11.5; over half of those born develop a wasted phenotype, lethargy and watery diarrhea and die during the first few weeks of life exhibiting dysmorphogenesis and altered differentiation of small intestinal epithelium. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	T	5: 63,898,839		probably benign	Het
4930402H24Rik	A	G	2: 130,767,647	I372T	probably damaging	Het
Atg4a-ps	A	G	3: 103,645,855	Y57H	probably damaging	Het
Bag4	C	T	8: 25,769,488	A228T	probably benign	Het
Bms1	G	A	6: 118,383,847	T1220I	probably damaging	Het
Brat1	T	C	5: 140,705,071		probably benign	Het
Casc1	A	T	6: 145,183,218		probably null	Het
Cds2	T	A	2: 132,294,446	Y39*	probably null	Het
Chrnd	T	A	1: 87,197,377	L384Q	probably damaging	Het
Cpa3	A	T	3: 20,228,817	Y155*	probably null	Het
Crlf1	G	A	8: 70,500,956	W260*	probably null	Het
Cux1	C	G	5: 136,312,722	E605D	probably damaging	Het
Cylc2	C	G	4: 51,229,651	T331R	unknown	Het
Dmtf1	T	C	5: 9,136,085	N167S	probably damaging	Het
Dtx2	T	A	5: 136,012,076	W112R	probably damaging	Het
F11	T	A	8: 45,241,474	I617F	probably damaging	Het
Fdps	A	T	3: 89,100,786	D8E	possibly damaging	Het
Fzd10	C	A	5: 128,601,276	T20K	probably benign	Het
Gm9978	T	A	10: 78,486,916		noncoding transcript	Het
Gpr158	T	A	2: 21,826,999	M970K	probably damaging	Het
Has1	C	T	17: 17,843,995	V461M	probably benign	Het
Hdac3	C	T	18: 37,952,513	G80D	probably benign	Het
Klk12	A	T	7: 43,773,383	R245W	probably damaging	Het
Lamp5	A	G	2: 136,059,020	I47V	probably damaging	Het
Olfr786	T	C	10: 129,437,064	I84T	probably benign	Het
Ovgp1	A	G	3: 105,977,711	D122G	probably benign	Het
Piezo1	T	C	8: 122,486,396	E1875G	probably benign	Het
Pih1d1	A	G	7: 45,158,497	M132V	possibly damaging	Het
Pon2	C	T	6: 5,267,021	A241T	probably benign	Het
Prkce	A	G	17: 86,619,911	I538V	possibly damaging	Het
Rab36	C	T	10: 75,052,043	R249*	probably null	Het
Rps6kl1	C	T	12: 85,147,808	A110T	probably damaging	Het
Rsad1	T	C	11: 94,544,530	T244A	probably benign	Het
Slc22a7	T	C	17: 46,432,510	I532V	probably benign	Het
Slc2a7	T	C	4: 150,163,274	V377A	possibly damaging	Het
Slx4	A	G	16: 3,989,055	V508A	possibly damaging	Het
Stag2	A	G	X: 42,233,872	S400G	probably benign	Het
Stat6	T	G	10: 127,651,228	I201M	probably damaging	Het
Stim2	T	C	5: 54,116,194		probably null	Het
Tbc1d9	A	G	8: 83,210,478	Y63C	probably damaging	Het
Tctn2	T	C	5: 124,620,189		noncoding transcript	Het
Tmem181a	T	A	17: 6,295,786	L185H	probably damaging	Het
Ubr5	T	A	15: 38,004,336	T1282S	probably damaging	Het
Ufl1	A	T	4: 25,254,806	I550N	probably damaging	Het
Uty	A	G	Y: 1,158,372	V557A	possibly damaging	Het
Vmn1r54	T	C	6: 90,269,271	S56P	probably damaging	Het
Zfp980	G	A	4: 145,702,083	G461S	probably benign	Het

Other mutations in Elf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02141:Elf3	APN	1	135257707	missense	possibly damaging	0.94
IGL02470:Elf3	APN	1	135255012	missense	probably damaging	1.00
IGL03018:Elf3	APN	1	135256065	missense	possibly damaging	0.62
IGL03252:Elf3	APN	1	135254953	missense	probably damaging	1.00
P0026:Elf3	UTSW	1	135255973	critical splice donor site	probably null
R0087:Elf3	UTSW	1	135257137	missense	probably damaging	1.00
R1842:Elf3	UTSW	1	135256793	missense	possibly damaging	0.65
R1897:Elf3	UTSW	1	135257137	missense	probably damaging	1.00
R2081:Elf3	UTSW	1	135257076	missense	probably benign	0.12
R4049:Elf3	UTSW	1	135254277	missense	probably benign	0.21
R4630:Elf3	UTSW	1	135256740	intron	probably benign
R4715:Elf3	UTSW	1	135257752	missense	probably damaging	1.00
R4923:Elf3	UTSW	1	135256735	intron	probably benign
R5226:Elf3	UTSW	1	135257239	missense	probably benign	0.07
R5422:Elf3	UTSW	1	135255040	missense	probably damaging	0.98
R5706:Elf3	UTSW	1	135256482	missense	probably benign	0.01
R7115:Elf3	UTSW	1	135257118	missense	probably damaging	1.00
R7644:Elf3	UTSW	1	135256506	missense	possibly damaging	0.89
R7855:Elf3	UTSW	1	135254352	missense	probably damaging	1.00
R7938:Elf3	UTSW	1	135254352	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTAGAGAGGCCCAGGATACC -3'
(R):5'- TCGGGACCTCAGTAAGTCTAGG -3'

Sequencing Primer
(F):5'- TCCAGGGACCACAGAAATGACTATG -3'
(R):5'- ACCTCAGTAAGTCTAGGCTGGG -3'

Posted On

2015-07-21