Mutagenetix > Incidental Mutations

Incidental Mutation 'R4467:Fdps'

329221

Institutional Source

Beutler Lab

Gene Symbol

Fdps

Ensembl Gene

ENSMUSG00000059743

Gene Name

farnesyl diphosphate synthetase

Synonyms

6030492I17Rik, Fdpsl1

MMRRC Submission

041724-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.960) question?

Stock #

R4467 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

89093588-89101959 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 89100786 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 8 (D8E)

Ref Sequence

ENSEMBL: ENSMUSP00000142393 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081848] [ENSMUST00000196709] [ENSMUST00000196921] [ENSMUST00000199668] [ENSMUST00000200659]

Predicted Effect

probably benign
Transcript: ENSMUST00000081848
AA Change: D8E

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000080531
Gene: ENSMUSG00000059743
AA Change: D8E

Domain	Start	End	E-Value	Type
Pfam:polyprenyl_synt	47	313	2e-82	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000103960

Predicted Effect

probably benign
Transcript: ENSMUST00000196709
AA Change: D8E

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000142770
Gene: ENSMUSG00000059743
AA Change: D8E

Domain	Start	End	E-Value	Type
Pfam:polyprenyl_synt	44	316	8.7e-84	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000196921
AA Change: D75E

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000142704
Gene: ENSMUSG00000059743
AA Change: D75E

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:polyprenyl_synt	111	226	7.9e-30	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198239

Predicted Effect

possibly damaging
Transcript: ENSMUST00000199668
AA Change: D8E

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000142393
Gene: ENSMUSG00000059743
AA Change: D8E

Domain	Start	End	E-Value	Type
Pfam:polyprenyl_synt	44	121	3.2e-22	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200433

Predicted Effect

possibly damaging
Transcript: ENSMUST00000200659
AA Change: D75E

PolyPhen 2 Score 0.678 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000142694
Gene: ENSMUSG00000105204
AA Change: D75E

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:polyprenyl_synt	111	334	3.2e-55	PFAM
low complexity region	548	559	N/A	INTRINSIC
RUN	560	628	9.3e-19	SMART
low complexity region	640	654	N/A	INTRINSIC
low complexity region	673	685	N/A	INTRINSIC
low complexity region	724	741	N/A	INTRINSIC
SH3	809	862	2.8e-10	SMART

Meta Mutation Damage Score

0.1962

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 95.0%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the production of geranyl pyrophosphate and farnesyl pyrophosphate from isopentenyl pyrophosphate and dimethylallyl pyrophosphate. The resulting product, farnesyl pyrophosphate, is a key intermediate in cholesterol and sterol biosynthesis, a substrate for protein farnesylation and geranylgeranylation, and a ligand or agonist for certain hormone receptors and growth receptors. Drugs that inhibit this enzyme prevent the post-translational modifications of small GTPases and have been used to treat diseases related to bone resorption. Multiple pseudogenes have been found on chromosomes 1, 7, 14, 15, 21 and X. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2008]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	T	5: 63,898,839		probably benign	Het
4930402H24Rik	A	G	2: 130,767,647	I372T	probably damaging	Het
Atg4a-ps	A	G	3: 103,645,855	Y57H	probably damaging	Het
Bag4	C	T	8: 25,769,488	A228T	probably benign	Het
Bms1	G	A	6: 118,383,847	T1220I	probably damaging	Het
Brat1	T	C	5: 140,705,071		probably benign	Het
Casc1	A	T	6: 145,183,218		probably null	Het
Cds2	T	A	2: 132,294,446	Y39*	probably null	Het
Chrnd	T	A	1: 87,197,377	L384Q	probably damaging	Het
Cpa3	A	T	3: 20,228,817	Y155*	probably null	Het
Crlf1	G	A	8: 70,500,956	W260*	probably null	Het
Cux1	C	G	5: 136,312,722	E605D	probably damaging	Het
Cylc2	C	G	4: 51,229,651	T331R	unknown	Het
Dmtf1	T	C	5: 9,136,085	N167S	probably damaging	Het
Dtx2	T	A	5: 136,012,076	W112R	probably damaging	Het
Elf3	A	G	1: 135,256,844	I138T	probably damaging	Het
F11	T	A	8: 45,241,474	I617F	probably damaging	Het
Fzd10	C	A	5: 128,601,276	T20K	probably benign	Het
Gm9978	T	A	10: 78,486,916		noncoding transcript	Het
Gpr158	T	A	2: 21,826,999	M970K	probably damaging	Het
Has1	C	T	17: 17,843,995	V461M	probably benign	Het
Hdac3	C	T	18: 37,952,513	G80D	probably benign	Het
Klk12	A	T	7: 43,773,383	R245W	probably damaging	Het
Lamp5	A	G	2: 136,059,020	I47V	probably damaging	Het
Olfr786	T	C	10: 129,437,064	I84T	probably benign	Het
Ovgp1	A	G	3: 105,977,711	D122G	probably benign	Het
Piezo1	T	C	8: 122,486,396	E1875G	probably benign	Het
Pih1d1	A	G	7: 45,158,497	M132V	possibly damaging	Het
Pon2	C	T	6: 5,267,021	A241T	probably benign	Het
Prkce	A	G	17: 86,619,911	I538V	possibly damaging	Het
Rab36	C	T	10: 75,052,043	R249*	probably null	Het
Rps6kl1	C	T	12: 85,147,808	A110T	probably damaging	Het
Rsad1	T	C	11: 94,544,530	T244A	probably benign	Het
Slc22a7	T	C	17: 46,432,510	I532V	probably benign	Het
Slc2a7	T	C	4: 150,163,274	V377A	possibly damaging	Het
Slx4	A	G	16: 3,989,055	V508A	possibly damaging	Het
Stag2	A	G	X: 42,233,872	S400G	probably benign	Het
Stat6	T	G	10: 127,651,228	I201M	probably damaging	Het
Stim2	T	C	5: 54,116,194		probably null	Het
Tbc1d9	A	G	8: 83,210,478	Y63C	probably damaging	Het
Tctn2	T	C	5: 124,620,189		noncoding transcript	Het
Tmem181a	T	A	17: 6,295,786	L185H	probably damaging	Het
Ubr5	T	A	15: 38,004,336	T1282S	probably damaging	Het
Ufl1	A	T	4: 25,254,806	I550N	probably damaging	Het
Uty	A	G	Y: 1,158,372	V557A	possibly damaging	Het
Vmn1r54	T	C	6: 90,269,271	S56P	probably damaging	Het
Zfp980	G	A	4: 145,702,083	G461S	probably benign	Het

Other mutations in Fdps

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01361:Fdps	APN	3	89094442	splice site	probably benign
IGL01364:Fdps	APN	3	89094270	nonsense	probably null
broadside	UTSW	3	89100761	missense	probably damaging	1.00
R0245:Fdps	UTSW	3	89093771	missense	possibly damaging	0.84
R0385:Fdps	UTSW	3	89094894	missense	probably damaging	1.00
R1674:Fdps	UTSW	3	89100730	missense	probably benign	0.33
R1820:Fdps	UTSW	3	89095043	missense	probably benign
R5106:Fdps	UTSW	3	89099403	missense	probably damaging	0.99
R5700:Fdps	UTSW	3	89095649	missense	probably damaging	1.00
R6128:Fdps	UTSW	3	89099433	missense	possibly damaging	0.77
R6791:Fdps	UTSW	3	89095352	critical splice donor site	probably null
R6800:Fdps	UTSW	3	89100761	missense	probably damaging	1.00
R6812:Fdps	UTSW	3	89094476	missense	possibly damaging	0.51
R6927:Fdps	UTSW	3	89093651	missense	probably benign	0.41
R7585:Fdps	UTSW	3	89093806	missense	probably benign	0.17
R7599:Fdps	UTSW	3	89099386	missense	probably benign	0.05
R7691:Fdps	UTSW	3	89099367	missense	probably benign	0.01
R7709:Fdps	UTSW	3	89101090	missense	probably damaging	0.97
R8035:Fdps	UTSW	3	89095476	missense	probably benign	0.04
R8132:Fdps	UTSW	3	89099386	nonsense	probably null
R8297:Fdps	UTSW	3	89093741	missense	probably damaging	0.99
R8323:Fdps	UTSW	3	89095389	missense	possibly damaging	0.93
X0060:Fdps	UTSW	3	89094314	missense	possibly damaging	0.54

Predicted Primers

PCR Primer
(F):5'- AGACCCAGGTAGTCACTTCG -3'
(R):5'- GGTTTCCTACAACGACCCTC -3'

Sequencing Primer
(F):5'- GGTAGTCACTTCGCTCTTATCGAAAC -3'
(R):5'- CTCCCTGGCATATGGGTGTC -3'

Posted On

2015-07-21