Incidental Mutation 'R4467:Ufl1'
ID329224
Institutional Source Beutler Lab
Gene Symbol Ufl1
Ensembl Gene ENSMUSG00000040359
Gene NameUFM1 specific ligase 1
Synonyms1810074P20Rik, Maxer, Rcad
MMRRC Submission 041724-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.891) question?
Stock #R4467 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location25248600-25281821 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25254806 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 550 (I550N)
Ref Sequence ENSEMBL: ENSMUSP00000100059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038705] [ENSMUST00000102994]
Predicted Effect probably damaging
Transcript: ENSMUST00000038705
AA Change: I470N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042118
Gene: ENSMUSG00000040359
AA Change: I470N

DomainStartEndE-ValueType
Pfam:DUF2042 2 205 1.5e-70 PFAM
low complexity region 334 344 N/A INTRINSIC
low complexity region 348 358 N/A INTRINSIC
low complexity region 364 374 N/A INTRINSIC
low complexity region 375 385 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102994
AA Change: I550N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100059
Gene: ENSMUSG00000040359
AA Change: I550N

DomainStartEndE-ValueType
Pfam:DUF2042 7 284 4.8e-117 PFAM
low complexity region 414 424 N/A INTRINSIC
low complexity region 428 438 N/A INTRINSIC
low complexity region 444 454 N/A INTRINSIC
low complexity region 455 465 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124792
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142949
Meta Mutation Damage Score 0.6325 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 98% (52/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality during organogensis, anemia and decreased erythroid progenitor cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
4930402H24Rik A G 2: 130,767,647 I372T probably damaging Het
Atg4a-ps A G 3: 103,645,855 Y57H probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bms1 G A 6: 118,383,847 T1220I probably damaging Het
Brat1 T C 5: 140,705,071 probably benign Het
Casc1 A T 6: 145,183,218 probably null Het
Cds2 T A 2: 132,294,446 Y39* probably null Het
Chrnd T A 1: 87,197,377 L384Q probably damaging Het
Cpa3 A T 3: 20,228,817 Y155* probably null Het
Crlf1 G A 8: 70,500,956 W260* probably null Het
Cux1 C G 5: 136,312,722 E605D probably damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Dmtf1 T C 5: 9,136,085 N167S probably damaging Het
Dtx2 T A 5: 136,012,076 W112R probably damaging Het
Elf3 A G 1: 135,256,844 I138T probably damaging Het
F11 T A 8: 45,241,474 I617F probably damaging Het
Fdps A T 3: 89,100,786 D8E possibly damaging Het
Fzd10 C A 5: 128,601,276 T20K probably benign Het
Gm9978 T A 10: 78,486,916 noncoding transcript Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Has1 C T 17: 17,843,995 V461M probably benign Het
Hdac3 C T 18: 37,952,513 G80D probably benign Het
Klk12 A T 7: 43,773,383 R245W probably damaging Het
Lamp5 A G 2: 136,059,020 I47V probably damaging Het
Olfr786 T C 10: 129,437,064 I84T probably benign Het
Ovgp1 A G 3: 105,977,711 D122G probably benign Het
Piezo1 T C 8: 122,486,396 E1875G probably benign Het
Pih1d1 A G 7: 45,158,497 M132V possibly damaging Het
Pon2 C T 6: 5,267,021 A241T probably benign Het
Prkce A G 17: 86,619,911 I538V possibly damaging Het
Rab36 C T 10: 75,052,043 R249* probably null Het
Rps6kl1 C T 12: 85,147,808 A110T probably damaging Het
Rsad1 T C 11: 94,544,530 T244A probably benign Het
Slc22a7 T C 17: 46,432,510 I532V probably benign Het
Slc2a7 T C 4: 150,163,274 V377A possibly damaging Het
Slx4 A G 16: 3,989,055 V508A possibly damaging Het
Stag2 A G X: 42,233,872 S400G probably benign Het
Stat6 T G 10: 127,651,228 I201M probably damaging Het
Stim2 T C 5: 54,116,194 probably null Het
Tbc1d9 A G 8: 83,210,478 Y63C probably damaging Het
Tctn2 T C 5: 124,620,189 noncoding transcript Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ubr5 T A 15: 38,004,336 T1282S probably damaging Het
Uty A G Y: 1,158,372 V557A possibly damaging Het
Vmn1r54 T C 6: 90,269,271 S56P probably damaging Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Ufl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Ufl1 APN 4 25280631 missense possibly damaging 0.67
IGL00899:Ufl1 APN 4 25262238 missense probably damaging 1.00
IGL00928:Ufl1 APN 4 25267790 missense probably damaging 1.00
IGL00949:Ufl1 APN 4 25275822 missense probably damaging 0.99
IGL02179:Ufl1 APN 4 25254896 missense probably damaging 0.99
IGL02228:Ufl1 APN 4 25281686 missense probably benign
IGL02237:Ufl1 APN 4 25269082 missense probably benign 0.01
IGL02294:Ufl1 APN 4 25259281 nonsense probably null
IGL02331:Ufl1 APN 4 25251971 missense probably damaging 1.00
IGL02374:Ufl1 APN 4 25259237 missense probably benign 0.01
IGL02541:Ufl1 APN 4 25250534 missense possibly damaging 0.56
IGL03053:Ufl1 APN 4 25275833 missense probably damaging 0.99
R0054:Ufl1 UTSW 4 25269087 missense probably damaging 0.96
R0054:Ufl1 UTSW 4 25269087 missense probably damaging 0.96
R0164:Ufl1 UTSW 4 25256008 missense probably benign 0.00
R0164:Ufl1 UTSW 4 25256008 missense probably benign 0.00
R0172:Ufl1 UTSW 4 25280685 missense probably benign 0.32
R2069:Ufl1 UTSW 4 25269036 missense possibly damaging 0.75
R4320:Ufl1 UTSW 4 25278601 splice site probably null
R4993:Ufl1 UTSW 4 25267832 missense possibly damaging 0.70
R5049:Ufl1 UTSW 4 25254773 missense probably benign 0.17
R5071:Ufl1 UTSW 4 25254780 missense probably benign
R5072:Ufl1 UTSW 4 25254780 missense probably benign
R5073:Ufl1 UTSW 4 25254780 missense probably benign
R5099:Ufl1 UTSW 4 25275914 missense probably damaging 0.99
R5108:Ufl1 UTSW 4 25269026 critical splice donor site probably null
R5127:Ufl1 UTSW 4 25256010 missense probably benign 0.05
R5262:Ufl1 UTSW 4 25251294 intron probably benign
R5409:Ufl1 UTSW 4 25280706 missense probably damaging 1.00
R5942:Ufl1 UTSW 4 25250619 missense probably benign
R6031:Ufl1 UTSW 4 25278038 missense probably benign 0.09
R6031:Ufl1 UTSW 4 25278038 missense probably benign 0.09
R6107:Ufl1 UTSW 4 25251999 missense possibly damaging 0.88
R6157:Ufl1 UTSW 4 25279350 missense possibly damaging 0.83
R6296:Ufl1 UTSW 4 25270572 missense probably benign
R6360:Ufl1 UTSW 4 25265476 missense probably benign
R6514:Ufl1 UTSW 4 25262238 missense probably damaging 1.00
R6754:Ufl1 UTSW 4 25267796 nonsense probably null
R6755:Ufl1 UTSW 4 25262316 missense probably damaging 0.96
R7196:Ufl1 UTSW 4 25250669 missense probably benign 0.05
R7247:Ufl1 UTSW 4 25254637 missense probably damaging 1.00
R7287:Ufl1 UTSW 4 25254852 missense probably benign 0.04
R7755:Ufl1 UTSW 4 25262274 missense probably benign
RF037:Ufl1 UTSW 4 25280628 missense possibly damaging 0.67
RF039:Ufl1 UTSW 4 25280628 missense possibly damaging 0.67
V7732:Ufl1 UTSW 4 25251368 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATATCGGTACACACTGTCTTCAGC -3'
(R):5'- TTTTAACTGCTAGAAAGATGGAGGG -3'

Sequencing Primer
(F):5'- GGTACACACTGTCTTCAGCAAGTG -3'
(R):5'- GGAGGGTTTTTAAAATGTTATTGCAC -3'
Posted On2015-07-21