Mutagenetix > Incidental Mutations

Incidental Mutation 'R4467:Dmtf1'

329227

Institutional Source

Beutler Lab

Gene Symbol

Dmtf1

Ensembl Gene

ENSMUSG00000042508

Gene Name

cyclin D binding myb-like transcription factor 1

Synonyms

Dmp1

MMRRC Submission

041724-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.856) question?

Stock #

R4467 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

9118801-9161776 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 9136085 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 167 (N167S)

Ref Sequence

ENSEMBL: ENSMUSP00000139164 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071921] [ENSMUST00000095017] [ENSMUST00000183448] [ENSMUST00000183525] [ENSMUST00000183973] [ENSMUST00000184120] [ENSMUST00000184159] [ENSMUST00000184372] [ENSMUST00000184401] [ENSMUST00000184620] [ENSMUST00000184888] [ENSMUST00000196029]

Predicted Effect

probably damaging
Transcript: ENSMUST00000071921
AA Change: N167S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000071815
Gene: ENSMUSG00000042508
AA Change: N167S

Domain	Start	End	E-Value	Type
SANT	223	270	2.52e-10	SMART
SANT	272	331	6.05e-13	SMART
SANT	335	390	5.36e-5	SMART
low complexity region	522	542	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000095017
AA Change: N167S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000092627
Gene: ENSMUSG00000042508
AA Change: N167S

Domain	Start	End	E-Value	Type
SANT	223	270	2.52e-10	SMART
SANT	272	331	6.05e-13	SMART
SANT	335	390	5.36e-5	SMART
low complexity region	452	472	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000183448
AA Change: N167S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139042
Gene: ENSMUSG00000042508
AA Change: N167S

Domain	Start	End	E-Value	Type
Blast:SANT	152	226	4e-48	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000183525
AA Change: N167S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000139339
Gene: ENSMUSG00000042508
AA Change: N167S

Domain	Start	End	E-Value	Type
Blast:SANT	152	191	2e-20	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183792

Predicted Effect

probably damaging
Transcript: ENSMUST00000183973
AA Change: N79S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139361
Gene: ENSMUSG00000042508
AA Change: N79S

Domain	Start	End	E-Value	Type
SANT	135	182	2.52e-10	SMART
SANT	184	243	6.05e-13	SMART
SANT	247	302	5.36e-5	SMART
low complexity region	434	454	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000184120
AA Change: N167S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138861
Gene: ENSMUSG00000042508
AA Change: N167S

Domain	Start	End	E-Value	Type
Blast:SANT	152	226	6e-48	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000184159
AA Change: N126S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139231
Gene: ENSMUSG00000042508
AA Change: N126S

Domain	Start	End	E-Value	Type
SANT	182	229	2.52e-10	SMART
SANT	231	290	6.05e-13	SMART
SANT	294	349	5.36e-5	SMART
low complexity region	391	406	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000184372
AA Change: N167S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139191
Gene: ENSMUSG00000042508
AA Change: N167S

Domain	Start	End	E-Value	Type
Blast:SANT	152	226	7e-49	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000184401
AA Change: N167S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139281
Gene: ENSMUSG00000042508
AA Change: N167S

Domain	Start	End	E-Value	Type
Blast:SANT	152	226	4e-48	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000184620
AA Change: N126S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138816
Gene: ENSMUSG00000042508
AA Change: N126S

Domain	Start	End	E-Value	Type
Blast:SANT	111	185	4e-48	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000184888
AA Change: N167S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139164
Gene: ENSMUSG00000042508
AA Change: N167S

Domain	Start	End	E-Value	Type
Blast:SANT	152	226	4e-48	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184903

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184947

Predicted Effect

probably benign
Transcript: ENSMUST00000196029

Meta Mutation Damage Score

0.2612

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 95.0%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that contains a cyclin D-binding domain, three central Myb-like repeats, and two flanking acidic transactivation domains at the N- and C-termini. The encoded protein is induced by the oncogenic Ras signaling pathway and functions as a tumor suppressor by activating the transcription of ARF and thus the ARF-p53 pathway to arrest cell growth or induce apoptosis. It also activates the transcription of aminopeptidase N and may play a role in hematopoietic cell differentiation. The transcriptional activity of this protein is regulated by binding of D-cyclins. This gene is hemizygously deleted in approximately 40% of human non-small-cell lung cancer and is a potential prognostic and gene-therapy target for non-small-cell lung cancer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous mutants exhibit partial postnatal lethality, small size, and decreased thymocyte number. Some mutants exhibit seizures and/or obstructive uropathy. Males have dilated seminal vesicles. Mice develop spontaneous tumors in the second year of life, and are susceptible to induced tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	T	5: 63,898,839		probably benign	Het
4930402H24Rik	A	G	2: 130,767,647	I372T	probably damaging	Het
Atg4a-ps	A	G	3: 103,645,855	Y57H	probably damaging	Het
Bag4	C	T	8: 25,769,488	A228T	probably benign	Het
Bms1	G	A	6: 118,383,847	T1220I	probably damaging	Het
Brat1	T	C	5: 140,705,071		probably benign	Het
Casc1	A	T	6: 145,183,218		probably null	Het
Cds2	T	A	2: 132,294,446	Y39*	probably null	Het
Chrnd	T	A	1: 87,197,377	L384Q	probably damaging	Het
Cpa3	A	T	3: 20,228,817	Y155*	probably null	Het
Crlf1	G	A	8: 70,500,956	W260*	probably null	Het
Cux1	C	G	5: 136,312,722	E605D	probably damaging	Het
Cylc2	C	G	4: 51,229,651	T331R	unknown	Het
Dtx2	T	A	5: 136,012,076	W112R	probably damaging	Het
Elf3	A	G	1: 135,256,844	I138T	probably damaging	Het
F11	T	A	8: 45,241,474	I617F	probably damaging	Het
Fdps	A	T	3: 89,100,786	D8E	possibly damaging	Het
Fzd10	C	A	5: 128,601,276	T20K	probably benign	Het
Gm9978	T	A	10: 78,486,916		noncoding transcript	Het
Gpr158	T	A	2: 21,826,999	M970K	probably damaging	Het
Has1	C	T	17: 17,843,995	V461M	probably benign	Het
Hdac3	C	T	18: 37,952,513	G80D	probably benign	Het
Klk12	A	T	7: 43,773,383	R245W	probably damaging	Het
Lamp5	A	G	2: 136,059,020	I47V	probably damaging	Het
Olfr786	T	C	10: 129,437,064	I84T	probably benign	Het
Ovgp1	A	G	3: 105,977,711	D122G	probably benign	Het
Piezo1	T	C	8: 122,486,396	E1875G	probably benign	Het
Pih1d1	A	G	7: 45,158,497	M132V	possibly damaging	Het
Pon2	C	T	6: 5,267,021	A241T	probably benign	Het
Prkce	A	G	17: 86,619,911	I538V	possibly damaging	Het
Rab36	C	T	10: 75,052,043	R249*	probably null	Het
Rps6kl1	C	T	12: 85,147,808	A110T	probably damaging	Het
Rsad1	T	C	11: 94,544,530	T244A	probably benign	Het
Slc22a7	T	C	17: 46,432,510	I532V	probably benign	Het
Slc2a7	T	C	4: 150,163,274	V377A	possibly damaging	Het
Slx4	A	G	16: 3,989,055	V508A	possibly damaging	Het
Stag2	A	G	X: 42,233,872	S400G	probably benign	Het
Stat6	T	G	10: 127,651,228	I201M	probably damaging	Het
Stim2	T	C	5: 54,116,194		probably null	Het
Tbc1d9	A	G	8: 83,210,478	Y63C	probably damaging	Het
Tctn2	T	C	5: 124,620,189		noncoding transcript	Het
Tmem181a	T	A	17: 6,295,786	L185H	probably damaging	Het
Ubr5	T	A	15: 38,004,336	T1282S	probably damaging	Het
Ufl1	A	T	4: 25,254,806	I550N	probably damaging	Het
Uty	A	G	Y: 1,158,372	V557A	possibly damaging	Het
Vmn1r54	T	C	6: 90,269,271	S56P	probably damaging	Het
Zfp980	G	A	4: 145,702,083	G461S	probably benign	Het

Other mutations in Dmtf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02215:Dmtf1	APN	5	9136070	missense	probably damaging	1.00
IGL02323:Dmtf1	APN	5	9120056	missense	possibly damaging	0.96
IGL02652:Dmtf1	APN	5	9121853	missense	probably benign	0.01
IGL02680:Dmtf1	APN	5	9130381	missense	probably benign	0.01
IGL02732:Dmtf1	APN	5	9136098	missense	possibly damaging	0.77
IGL03002:Dmtf1	APN	5	9140474	missense	probably damaging	1.00
IGL03074:Dmtf1	APN	5	9124435	intron	probably benign
R0149:Dmtf1	UTSW	5	9132571	missense	probably damaging	1.00
R0466:Dmtf1	UTSW	5	9132454	critical splice donor site	probably null
R0825:Dmtf1	UTSW	5	9130388	missense	probably damaging	1.00
R0973:Dmtf1	UTSW	5	9127987	missense	possibly damaging	0.51
R0973:Dmtf1	UTSW	5	9127987	missense	possibly damaging	0.51
R0974:Dmtf1	UTSW	5	9127987	missense	possibly damaging	0.51
R1068:Dmtf1	UTSW	5	9136109	missense	probably damaging	1.00
R1293:Dmtf1	UTSW	5	9140383	splice site	probably null
R1478:Dmtf1	UTSW	5	9121404	missense	possibly damaging	0.93
R1515:Dmtf1	UTSW	5	9140384	critical splice donor site	probably null
R1861:Dmtf1	UTSW	5	9120347	splice site	probably null
R1898:Dmtf1	UTSW	5	9128091	missense	probably damaging	0.99
R1970:Dmtf1	UTSW	5	9148989	missense	probably benign	0.01
R1971:Dmtf1	UTSW	5	9148989	missense	probably benign	0.01
R2519:Dmtf1	UTSW	5	9129323	missense	possibly damaging	0.71
R3053:Dmtf1	UTSW	5	9129316	missense	probably damaging	0.99
R3195:Dmtf1	UTSW	5	9132454	intron	probably benign
R4490:Dmtf1	UTSW	5	9140379	intron	probably benign
R4491:Dmtf1	UTSW	5	9140379	intron	probably benign
R5007:Dmtf1	UTSW	5	9122439	unclassified	probably benign
R5173:Dmtf1	UTSW	5	9140356	intron	probably benign
R5184:Dmtf1	UTSW	5	9126641	missense	probably benign	0.36
R5646:Dmtf1	UTSW	5	9124515	missense	possibly damaging	0.62
R5958:Dmtf1	UTSW	5	9122415	unclassified	probably benign
R5977:Dmtf1	UTSW	5	9140451	missense	probably damaging	0.99
R6184:Dmtf1	UTSW	5	9126656	missense	probably benign
R6887:Dmtf1	UTSW	5	9137149	missense	probably damaging	1.00
R6921:Dmtf1	UTSW	5	9130654	intron	probably benign
R7242:Dmtf1	UTSW	5	9149016	missense	possibly damaging	0.90
R7706:Dmtf1	UTSW	5	9124489	missense	possibly damaging	0.86
R7721:Dmtf1	UTSW	5	9126564	missense	probably damaging	1.00
R7739:Dmtf1	UTSW	5	9140453	missense	probably damaging	1.00
R7742:Dmtf1	UTSW	5	9122457	unclassified	probably benign
R7859:Dmtf1	UTSW	5	9128044	missense	probably damaging	1.00
R7883:Dmtf1	UTSW	5	9140397	missense	probably benign	0.35
R7942:Dmtf1	UTSW	5	9128044	missense	probably damaging	1.00
R7966:Dmtf1	UTSW	5	9140397	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- AGTACCTATGATCACAGTAGCAC -3'
(R):5'- TAGCCTGGTTCTCTTCCTAGGG -3'

Sequencing Primer
(F):5'- CTATGATCACAGTAGCACAAAAGG -3'
(R):5'- GGTTCTCTTCCTAGGGACACAC -3'

Posted On

2015-07-21