Incidental Mutation 'R4467:Stim2'
ID329228
Institutional Source Beutler Lab
Gene Symbol Stim2
Ensembl Gene ENSMUSG00000039156
Gene Namestromal interaction molecule 2
Synonyms
MMRRC Submission 041724-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4467 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location53998499-54121057 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 54116194 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117661] [ENSMUST00000201469] [ENSMUST00000201469]
Predicted Effect probably null
Transcript: ENSMUST00000117661
SMART Domains Protein: ENSMUSP00000113174
Gene: ENSMUSG00000039156

DomainStartEndE-ValueType
low complexity region 23 47 N/A INTRINSIC
SAM 133 204 1.74e-3 SMART
PDB:4O9B|D 241 344 2e-36 PDB
PDB:3TEQ|D 348 448 2e-38 PDB
low complexity region 505 518 N/A INTRINSIC
low complexity region 527 557 N/A INTRINSIC
low complexity region 602 613 N/A INTRINSIC
low complexity region 730 746 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000201198
Predicted Effect probably null
Transcript: ENSMUST00000201469
SMART Domains Protein: ENSMUSP00000143855
Gene: ENSMUSG00000039156

DomainStartEndE-ValueType
low complexity region 23 47 N/A INTRINSIC
SAM 133 204 1.74e-3 SMART
PDB:4O9B|D 241 344 2e-36 PDB
Pfam:SOAR 345 453 1.7e-42 PFAM
low complexity region 513 526 N/A INTRINSIC
low complexity region 535 565 N/A INTRINSIC
low complexity region 610 621 N/A INTRINSIC
low complexity region 738 754 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000201469
SMART Domains Protein: ENSMUSP00000143855
Gene: ENSMUSG00000039156

DomainStartEndE-ValueType
low complexity region 23 47 N/A INTRINSIC
SAM 133 204 1.74e-3 SMART
PDB:4O9B|D 241 344 2e-36 PDB
Pfam:SOAR 345 453 1.7e-42 PFAM
low complexity region 513 526 N/A INTRINSIC
low complexity region 535 565 N/A INTRINSIC
low complexity region 610 621 N/A INTRINSIC
low complexity region 738 754 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202342
Meta Mutation Damage Score 0.9494 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the stromal interaction molecule (STIM) family and likely arose, along with related family member STIM1, from a common ancestral gene. The encoded protein functions to regulate calcium concentrations in the cytosol and endoplasmic reticulum, and is involved in the activation of plasma membrane Orai Ca(2+) entry channels. This gene initiates translation from a non-AUG (UUG) start site. A signal peptide is cleaved from the resulting protein. Multiple transcript variants result from alternative splicing. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit a slight growth delay and premature death while embryonic fibroblasts show reduced store-operated Ca2+ influx. Mice homozygous for a different null allele show increased neuron survival under hypoxic conditions and resistance to ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
4930402H24Rik A G 2: 130,767,647 I372T probably damaging Het
Atg4a-ps A G 3: 103,645,855 Y57H probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bms1 G A 6: 118,383,847 T1220I probably damaging Het
Brat1 T C 5: 140,705,071 probably benign Het
Casc1 A T 6: 145,183,218 probably null Het
Cds2 T A 2: 132,294,446 Y39* probably null Het
Chrnd T A 1: 87,197,377 L384Q probably damaging Het
Cpa3 A T 3: 20,228,817 Y155* probably null Het
Crlf1 G A 8: 70,500,956 W260* probably null Het
Cux1 C G 5: 136,312,722 E605D probably damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Dmtf1 T C 5: 9,136,085 N167S probably damaging Het
Dtx2 T A 5: 136,012,076 W112R probably damaging Het
Elf3 A G 1: 135,256,844 I138T probably damaging Het
F11 T A 8: 45,241,474 I617F probably damaging Het
Fdps A T 3: 89,100,786 D8E possibly damaging Het
Fzd10 C A 5: 128,601,276 T20K probably benign Het
Gm9978 T A 10: 78,486,916 noncoding transcript Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Has1 C T 17: 17,843,995 V461M probably benign Het
Hdac3 C T 18: 37,952,513 G80D probably benign Het
Klk12 A T 7: 43,773,383 R245W probably damaging Het
Lamp5 A G 2: 136,059,020 I47V probably damaging Het
Olfr786 T C 10: 129,437,064 I84T probably benign Het
Ovgp1 A G 3: 105,977,711 D122G probably benign Het
Piezo1 T C 8: 122,486,396 E1875G probably benign Het
Pih1d1 A G 7: 45,158,497 M132V possibly damaging Het
Pon2 C T 6: 5,267,021 A241T probably benign Het
Prkce A G 17: 86,619,911 I538V possibly damaging Het
Rab36 C T 10: 75,052,043 R249* probably null Het
Rps6kl1 C T 12: 85,147,808 A110T probably damaging Het
Rsad1 T C 11: 94,544,530 T244A probably benign Het
Slc22a7 T C 17: 46,432,510 I532V probably benign Het
Slc2a7 T C 4: 150,163,274 V377A possibly damaging Het
Slx4 A G 16: 3,989,055 V508A possibly damaging Het
Stag2 A G X: 42,233,872 S400G probably benign Het
Stat6 T G 10: 127,651,228 I201M probably damaging Het
Tbc1d9 A G 8: 83,210,478 Y63C probably damaging Het
Tctn2 T C 5: 124,620,189 noncoding transcript Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ubr5 T A 15: 38,004,336 T1282S probably damaging Het
Ufl1 A T 4: 25,254,806 I550N probably damaging Het
Uty A G Y: 1,158,372 V557A possibly damaging Het
Vmn1r54 T C 6: 90,269,271 S56P probably damaging Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Stim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Stim2 APN 5 54053493 missense probably benign 0.09
IGL02276:Stim2 APN 5 54053370 splice site probably benign
IGL02643:Stim2 APN 5 54110613 missense probably damaging 1.00
R0368:Stim2 UTSW 5 54110140 critical splice donor site probably null
R0825:Stim2 UTSW 5 54118483 missense probably benign 0.22
R1453:Stim2 UTSW 5 54116109 missense probably damaging 1.00
R1549:Stim2 UTSW 5 54105325 missense probably damaging 1.00
R2103:Stim2 UTSW 5 54105249 missense possibly damaging 0.74
R2114:Stim2 UTSW 5 54104477 missense probably damaging 1.00
R2147:Stim2 UTSW 5 54105375 missense probably damaging 1.00
R2159:Stim2 UTSW 5 54109814 missense probably damaging 1.00
R4809:Stim2 UTSW 5 54110613 missense probably damaging 1.00
R4857:Stim2 UTSW 5 54118546 missense probably damaging 1.00
R4959:Stim2 UTSW 5 54105370 missense probably benign
R5125:Stim2 UTSW 5 54110597 missense probably damaging 1.00
R5427:Stim2 UTSW 5 54110939 missense possibly damaging 0.95
R5441:Stim2 UTSW 5 54075370 nonsense probably null
R5617:Stim2 UTSW 5 54109733 missense probably damaging 0.99
R5924:Stim2 UTSW 5 54102643 missense probably benign 0.01
R6169:Stim2 UTSW 5 54118679 missense probably damaging 1.00
R6689:Stim2 UTSW 5 54115976 missense probably damaging 1.00
R6893:Stim2 UTSW 5 54053445 missense probably benign 0.13
R6971:Stim2 UTSW 5 54118299 nonsense probably null
R7133:Stim2 UTSW 5 53998921 missense possibly damaging 0.70
R7189:Stim2 UTSW 5 54116128 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GCAGTAGTTTATGCCGCTCTCG -3'
(R):5'- TCAACATTTTCTTAAGCCCTGGG -3'

Sequencing Primer
(F):5'- AGTCTCAGCGAGCTCAGCTTC -3'
(R):5'- CAAACCGACCTTATGCTTAGAGTGG -3'
Posted On2015-07-21