Mutagenetix > Incidental Mutation

Incidental Mutation 'R4467:Pih1d1'

329240

Institutional Source

Beutler Lab

Gene Symbol

Pih1d1

Ensembl Gene

ENSMUSG00000003423

Gene Name

PIH1 domain containing 1

Synonyms

1110061L23Rik, 4933413A04Rik, Nop17

MMRRC Submission

041724-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.568) question?

Stock #

R4467 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

45154303-45160065 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 45158497 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 132 (M132V)

Ref Sequence

ENSEMBL: ENSMUSP00000148186 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085375] [ENSMUST00000107811] [ENSMUST00000107815] [ENSMUST00000209847] [ENSMUST00000209954] [ENSMUST00000209957] [ENSMUST00000209963] [ENSMUST00000210139] [ENSMUST00000211709] [ENSMUST00000210125] [ENSMUST00000211414] [ENSMUST00000211362]

AlphaFold

Q9CQJ2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085375
AA Change: M132V

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000082490
Gene: ENSMUSG00000003423
AA Change: M132V

Domain	Start	End	E-Value	Type
Pfam:PIH1	23	207	1.8e-50	PFAM
Pfam:PIH1	211	285	2.3e-17	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107811
AA Change: M132V

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000103441
Gene: ENSMUSG00000003423
AA Change: M132V

Domain	Start	End	E-Value	Type
Pfam:PIH1	23	207	1.8e-50	PFAM
Pfam:PIH1	211	285	2.3e-17	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107813
AA Change: M132V

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000103443
Gene: ENSMUSG00000003423
AA Change: M132V

Domain	Start	End	E-Value	Type
Pfam:PIH1	22	209	7.6e-39	PFAM
Pfam:PIH1	205	285	1.3e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107815

SMART Domains

Protein: ENSMUSP00000103445
Gene: ENSMUSG00000007833

Domain	Start	End	E-Value	Type
Pfam:Aldedh	48	488	3.8e-87	PFAM
Pfam:Aldedh	536	753	2.7e-30	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000153973
AA Change: M132V

PolyPhen 2 Score 0.612 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000122727
Gene: ENSMUSG00000003423
AA Change: M132V

Domain	Start	End	E-Value	Type
Pfam:PIH1	20	136	1.3e-36	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209400

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209581

Predicted Effect

probably benign
Transcript: ENSMUST00000209847

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209889

Predicted Effect

possibly damaging
Transcript: ENSMUST00000209954
AA Change: M132V

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

probably benign
Transcript: ENSMUST00000209957

Predicted Effect

probably benign
Transcript: ENSMUST00000209963

Predicted Effect

possibly damaging
Transcript: ENSMUST00000210139
AA Change: M132V

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211336

Predicted Effect

probably benign
Transcript: ENSMUST00000211709

Predicted Effect

probably benign
Transcript: ENSMUST00000210125

Predicted Effect

probably benign
Transcript: ENSMUST00000211414

Predicted Effect

probably benign
Transcript: ENSMUST00000211362

Meta Mutation Damage Score

0.1079

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 95.0%

Validation Efficiency

98% (52/53)

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	T	5: 63,898,839		probably benign	Het
4930402H24Rik	A	G	2: 130,767,647	I372T	probably damaging	Het
Atg4a-ps	A	G	3: 103,645,855	Y57H	probably damaging	Het
Bag4	C	T	8: 25,769,488	A228T	probably benign	Het
Bms1	G	A	6: 118,383,847	T1220I	probably damaging	Het
Brat1	T	C	5: 140,705,071		probably benign	Het
Casc1	A	T	6: 145,183,218		probably null	Het
Cds2	T	A	2: 132,294,446	Y39*	probably null	Het
Chrnd	T	A	1: 87,197,377	L384Q	probably damaging	Het
Cpa3	A	T	3: 20,228,817	Y155*	probably null	Het
Crlf1	G	A	8: 70,500,956	W260*	probably null	Het
Cux1	C	G	5: 136,312,722	E605D	probably damaging	Het
Cylc2	C	G	4: 51,229,651	T331R	unknown	Het
Dmtf1	T	C	5: 9,136,085	N167S	probably damaging	Het
Dtx2	T	A	5: 136,012,076	W112R	probably damaging	Het
Elf3	A	G	1: 135,256,844	I138T	probably damaging	Het
F11	T	A	8: 45,241,474	I617F	probably damaging	Het
Fdps	A	T	3: 89,100,786	D8E	possibly damaging	Het
Fzd10	C	A	5: 128,601,276	T20K	probably benign	Het
Gm9978	T	A	10: 78,486,916		noncoding transcript	Het
Gpr158	T	A	2: 21,826,999	M970K	probably damaging	Het
Has1	C	T	17: 17,843,995	V461M	probably benign	Het
Hdac3	C	T	18: 37,952,513	G80D	probably benign	Het
Klk12	A	T	7: 43,773,383	R245W	probably damaging	Het
Lamp5	A	G	2: 136,059,020	I47V	probably damaging	Het
Olfr786	T	C	10: 129,437,064	I84T	probably benign	Het
Ovgp1	A	G	3: 105,977,711	D122G	probably benign	Het
Piezo1	T	C	8: 122,486,396	E1875G	probably benign	Het
Pon2	C	T	6: 5,267,021	A241T	probably benign	Het
Prkce	A	G	17: 86,619,911	I538V	possibly damaging	Het
Rab36	C	T	10: 75,052,043	R249*	probably null	Het
Rps6kl1	C	T	12: 85,147,808	A110T	probably damaging	Het
Rsad1	T	C	11: 94,544,530	T244A	probably benign	Het
Slc22a7	T	C	17: 46,432,510	I532V	probably benign	Het
Slc2a7	T	C	4: 150,163,274	V377A	possibly damaging	Het
Slx4	A	G	16: 3,989,055	V508A	possibly damaging	Het
Stag2	A	G	X: 42,233,872	S400G	probably benign	Het
Stat6	T	G	10: 127,651,228	I201M	probably damaging	Het
Stim2	T	C	5: 54,116,194		probably null	Het
Tbc1d9	A	G	8: 83,210,478	Y63C	probably damaging	Het
Tctn2	T	C	5: 124,620,189		noncoding transcript	Het
Tmem181a	T	A	17: 6,295,786	L185H	probably damaging	Het
Ubr5	T	A	15: 38,004,336	T1282S	probably damaging	Het
Ufl1	A	T	4: 25,254,806	I550N	probably damaging	Het
Uty	A	G	Y: 1,158,372	V557A	possibly damaging	Het
Vmn1r54	T	C	6: 90,269,271	S56P	probably damaging	Het
Zfp980	G	A	4: 145,702,083	G461S	probably benign	Het

Other mutations in Pih1d1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01295:Pih1d1	APN	7	45159964	missense	probably damaging	1.00
IGL01327:Pih1d1	APN	7	45159975	missense	probably benign	0.00
IGL02011:Pih1d1	APN	7	45156732	missense	probably damaging	1.00
IGL03145:Pih1d1	APN	7	45159121	critical splice donor site	probably null
R0659:Pih1d1	UTSW	7	45159975	missense	probably benign	0.06
R0686:Pih1d1	UTSW	7	45156329	nonsense	probably null
R0845:Pih1d1	UTSW	7	45159682	missense	probably benign	0.37
R0848:Pih1d1	UTSW	7	45157617	missense	probably damaging	1.00
R1679:Pih1d1	UTSW	7	45159826	critical splice donor site	probably null
R1894:Pih1d1	UTSW	7	45157741	missense	probably damaging	1.00
R4899:Pih1d1	UTSW	7	45154527	intron	probably benign
R5033:Pih1d1	UTSW	7	45154854	unclassified	probably benign
R5435:Pih1d1	UTSW	7	45156272	splice site	probably null
R6037:Pih1d1	UTSW	7	45156314	missense	probably damaging	0.98
R6037:Pih1d1	UTSW	7	45156314	missense	probably damaging	0.98
R6145:Pih1d1	UTSW	7	45159044	missense	probably damaging	0.99
R6564:Pih1d1	UTSW	7	45159819	missense	probably damaging	1.00
R7557:Pih1d1	UTSW	7	45156759	missense	probably benign	0.00
R8675:Pih1d1	UTSW	7	45154382	missense	unknown
R8821:Pih1d1	UTSW	7	45156772	missense	possibly damaging	0.67
R9109:Pih1d1	UTSW	7	45159769	missense	possibly damaging	0.59
R9497:Pih1d1	UTSW	7	45154365	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AAGTGTATGCTGCCTCTCAC -3'
(R):5'- ACTGGATTCACCTCTCCCAG -3'

Sequencing Primer
(F):5'- ACTTCCTGTGTCTTGGGTCTCTG -3'
(R):5'- GGATTCACCTCTCCCAGTGTAG -3'

Posted On

2015-07-21