Incidental Mutation 'R4467:Rsad1'
ID329250
Institutional Source Beutler Lab
Gene Symbol Rsad1
Ensembl Gene ENSMUSG00000039096
Gene Nameradical S-adenosyl methionine domain containing 1
Synonyms
MMRRC Submission 041724-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R4467 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location94539798-94549255 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94544530 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 244 (T244A)
Ref Sequence ENSEMBL: ENSMUSP00000037361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040487]
Predicted Effect probably benign
Transcript: ENSMUST00000040487
AA Change: T244A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037361
Gene: ENSMUSG00000039096
AA Change: T244A

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
Elp3 39 259 6.54e-40 SMART
Pfam:HemN_C 346 414 7.7e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148888
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
4930402H24Rik A G 2: 130,767,647 I372T probably damaging Het
Atg4a-ps A G 3: 103,645,855 Y57H probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bms1 G A 6: 118,383,847 T1220I probably damaging Het
Brat1 T C 5: 140,705,071 probably benign Het
Casc1 A T 6: 145,183,218 probably null Het
Cds2 T A 2: 132,294,446 Y39* probably null Het
Chrnd T A 1: 87,197,377 L384Q probably damaging Het
Cpa3 A T 3: 20,228,817 Y155* probably null Het
Crlf1 G A 8: 70,500,956 W260* probably null Het
Cux1 C G 5: 136,312,722 E605D probably damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Dmtf1 T C 5: 9,136,085 N167S probably damaging Het
Dtx2 T A 5: 136,012,076 W112R probably damaging Het
Elf3 A G 1: 135,256,844 I138T probably damaging Het
F11 T A 8: 45,241,474 I617F probably damaging Het
Fdps A T 3: 89,100,786 D8E possibly damaging Het
Fzd10 C A 5: 128,601,276 T20K probably benign Het
Gm9978 T A 10: 78,486,916 noncoding transcript Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Has1 C T 17: 17,843,995 V461M probably benign Het
Hdac3 C T 18: 37,952,513 G80D probably benign Het
Klk12 A T 7: 43,773,383 R245W probably damaging Het
Lamp5 A G 2: 136,059,020 I47V probably damaging Het
Olfr786 T C 10: 129,437,064 I84T probably benign Het
Ovgp1 A G 3: 105,977,711 D122G probably benign Het
Piezo1 T C 8: 122,486,396 E1875G probably benign Het
Pih1d1 A G 7: 45,158,497 M132V possibly damaging Het
Pon2 C T 6: 5,267,021 A241T probably benign Het
Prkce A G 17: 86,619,911 I538V possibly damaging Het
Rab36 C T 10: 75,052,043 R249* probably null Het
Rps6kl1 C T 12: 85,147,808 A110T probably damaging Het
Slc22a7 T C 17: 46,432,510 I532V probably benign Het
Slc2a7 T C 4: 150,163,274 V377A possibly damaging Het
Slx4 A G 16: 3,989,055 V508A possibly damaging Het
Stag2 A G X: 42,233,872 S400G probably benign Het
Stat6 T G 10: 127,651,228 I201M probably damaging Het
Stim2 T C 5: 54,116,194 probably null Het
Tbc1d9 A G 8: 83,210,478 Y63C probably damaging Het
Tctn2 T C 5: 124,620,189 noncoding transcript Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ubr5 T A 15: 38,004,336 T1282S probably damaging Het
Ufl1 A T 4: 25,254,806 I550N probably damaging Het
Uty A G Y: 1,158,372 V557A possibly damaging Het
Vmn1r54 T C 6: 90,269,271 S56P probably damaging Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Rsad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01104:Rsad1 APN 11 94543640 missense possibly damaging 0.65
IGL01915:Rsad1 APN 11 94548977 splice site probably null
R0271:Rsad1 UTSW 11 94548464 splice site probably benign
R0619:Rsad1 UTSW 11 94542639 missense probably damaging 1.00
R1147:Rsad1 UTSW 11 94544140 missense probably damaging 1.00
R1147:Rsad1 UTSW 11 94544140 missense probably damaging 1.00
R2069:Rsad1 UTSW 11 94549125 start gained probably benign
R3831:Rsad1 UTSW 11 94543304 missense probably benign 0.45
R3833:Rsad1 UTSW 11 94543304 missense probably benign 0.45
R4152:Rsad1 UTSW 11 94548623 intron probably benign
R4672:Rsad1 UTSW 11 94543618 missense probably damaging 0.99
R5452:Rsad1 UTSW 11 94543689 missense probably damaging 0.98
R6190:Rsad1 UTSW 11 94548236 missense probably damaging 1.00
R6608:Rsad1 UTSW 11 94542609 missense probably damaging 1.00
R6749:Rsad1 UTSW 11 94543340 missense probably damaging 1.00
R7821:Rsad1 UTSW 11 94544462 missense probably benign
R8818:Rsad1 UTSW 11 94548274 missense probably benign 0.20
X0024:Rsad1 UTSW 11 94548981 critical splice donor site probably null
Z1177:Rsad1 UTSW 11 94542985 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AAAGGTCTCAGTCCCTTGGTC -3'
(R):5'- TTTTCCCTGGCAGAGTGTC -3'

Sequencing Primer
(F):5'- AGTCCCTTGGTCAGTCTCAAC -3'
(R):5'- CCTGGCAGAGTGTCGGTGG -3'
Posted On2015-07-21