Mutagenetix > Incidental Mutations

Incidental Mutation 'R4467:Ubr5'

329252

Institutional Source

Beutler Lab

Gene Symbol

Ubr5

Ensembl Gene

ENSMUSG00000037487

Gene Name

ubiquitin protein ligase E3 component n-recognin 5

Synonyms

Edd, 4432411E13Rik, Edd1

MMRRC Submission

041724-MU

Accession Numbers

NCBI RefSeq: NM_001081359.2, NM_001112721.1; MGI:1918040

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4467 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

37967328-38078854 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 38004336 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 1282 (T1282S)

Ref Sequence

ENSEMBL: ENSMUSP00000154293 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110336] [ENSMUST00000226414]

Predicted Effect

probably damaging
Transcript: ENSMUST00000110336
AA Change: T1276S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000105965
Gene: ENSMUSG00000037487
AA Change: T1276S

Domain	Start	End	E-Value	Type
low complexity region	94	111	N/A	INTRINSIC
low complexity region	129	156	N/A	INTRINSIC
Pfam:E3_UbLigase_EDD	179	230	9.7e-35	PFAM
low complexity region	282	323	N/A	INTRINSIC
low complexity region	614	628	N/A	INTRINSIC
low complexity region	860	870	N/A	INTRINSIC
low complexity region	933	950	N/A	INTRINSIC
low complexity region	970	999	N/A	INTRINSIC
low complexity region	1140	1151	N/A	INTRINSIC
ZnF_UBR1	1177	1244	5.42e-27	SMART
low complexity region	1396	1405	N/A	INTRINSIC
low complexity region	1524	1537	N/A	INTRINSIC
low complexity region	1567	1613	N/A	INTRINSIC
low complexity region	1641	1657	N/A	INTRINSIC
low complexity region	1662	1687	N/A	INTRINSIC
low complexity region	1726	1742	N/A	INTRINSIC
low complexity region	1759	1789	N/A	INTRINSIC
low complexity region	1879	1890	N/A	INTRINSIC
low complexity region	1972	1983	N/A	INTRINSIC
low complexity region	1986	1997	N/A	INTRINSIC
Blast:HECTc	2271	2313	2e-6	BLAST
low complexity region	2329	2366	N/A	INTRINSIC
PolyA	2389	2452	3.97e-33	SMART
HECTc	2432	2798	1e-151	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226137

Predicted Effect

probably damaging
Transcript: ENSMUST00000226414
AA Change: T1282S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228101

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228174

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228504

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 95.0%

Validation Efficiency

98% (52/53)

MGI Phenotype

Strain: 3052764
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a progestin-induced protein, which belongs to the HECT (homology to E6-AP carboxyl terminus) family. The HECT family proteins function as E3 ubiquitin-protein ligases, targeting specific proteins for ubiquitin-mediated proteolysis. This gene is localized to chromosome 8q22 which is disrupted in a variety of cancers. This gene potentially has a role in regulation of cell proliferation or differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, impaired growth of the allantois, failure or impairment of chorioallantoic fusion, impaired angiogenesis in the yolk sac and allantois, decreased cell proliferation, and increased apoptosis. [provided by MGI curators]

Allele List at MGI

All alleles(151) : Targeted(3) Gene trapped(148)

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	T	5: 63,898,839		probably benign	Het
4930402H24Rik	A	G	2: 130,767,647	I372T	probably damaging	Het
Atg4a-ps	A	G	3: 103,645,855	Y57H	probably damaging	Het
Bag4	C	T	8: 25,769,488	A228T	probably benign	Het
Bms1	G	A	6: 118,383,847	T1220I	probably damaging	Het
Brat1	T	C	5: 140,705,071		probably benign	Het
Casc1	A	T	6: 145,183,218		probably null	Het
Cds2	T	A	2: 132,294,446	Y39*	probably null	Het
Chrnd	T	A	1: 87,197,377	L384Q	probably damaging	Het
Cpa3	A	T	3: 20,228,817	Y155*	probably null	Het
Crlf1	G	A	8: 70,500,956	W260*	probably null	Het
Cux1	C	G	5: 136,312,722	E605D	probably damaging	Het
Cylc2	C	G	4: 51,229,651	T331R	unknown	Het
Dmtf1	T	C	5: 9,136,085	N167S	probably damaging	Het
Dtx2	T	A	5: 136,012,076	W112R	probably damaging	Het
Elf3	A	G	1: 135,256,844	I138T	probably damaging	Het
F11	T	A	8: 45,241,474	I617F	probably damaging	Het
Fdps	A	T	3: 89,100,786	D8E	possibly damaging	Het
Fzd10	C	A	5: 128,601,276	T20K	probably benign	Het
Gm9978	T	A	10: 78,486,916		noncoding transcript	Het
Gpr158	T	A	2: 21,826,999	M970K	probably damaging	Het
Has1	C	T	17: 17,843,995	V461M	probably benign	Het
Hdac3	C	T	18: 37,952,513	G80D	probably benign	Het
Klk12	A	T	7: 43,773,383	R245W	probably damaging	Het
Lamp5	A	G	2: 136,059,020	I47V	probably damaging	Het
Olfr786	T	C	10: 129,437,064	I84T	probably benign	Het
Ovgp1	A	G	3: 105,977,711	D122G	probably benign	Het
Piezo1	T	C	8: 122,486,396	E1875G	probably benign	Het
Pih1d1	A	G	7: 45,158,497	M132V	possibly damaging	Het
Pon2	C	T	6: 5,267,021	A241T	probably benign	Het
Prkce	A	G	17: 86,619,911	I538V	possibly damaging	Het
Rab36	C	T	10: 75,052,043	R249*	probably null	Het
Rps6kl1	C	T	12: 85,147,808	A110T	probably damaging	Het
Rsad1	T	C	11: 94,544,530	T244A	probably benign	Het
Slc22a7	T	C	17: 46,432,510	I532V	probably benign	Het
Slc2a7	T	C	4: 150,163,274	V377A	possibly damaging	Het
Slx4	A	G	16: 3,989,055	V508A	possibly damaging	Het
Stag2	A	G	X: 42,233,872	S400G	probably benign	Het
Stat6	T	G	10: 127,651,228	I201M	probably damaging	Het
Stim2	T	C	5: 54,116,194		probably null	Het
Tbc1d9	A	G	8: 83,210,478	Y63C	probably damaging	Het
Tctn2	T	C	5: 124,620,189		noncoding transcript	Het
Tmem181a	T	A	17: 6,295,786	L185H	probably damaging	Het
Ufl1	A	T	4: 25,254,806	I550N	probably damaging	Het
Uty	A	G	Y: 1,158,372	V557A	possibly damaging	Het
Vmn1r54	T	C	6: 90,269,271	S56P	probably damaging	Het
Zfp980	G	A	4: 145,702,083	G461S	probably benign	Het

Other mutations in Ubr5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Ubr5	APN	15	37984036	missense	probably damaging	1.00
IGL00548:Ubr5	APN	15	38004321	missense	probably benign	0.11
IGL00675:Ubr5	APN	15	38018284	missense	possibly damaging	0.84
IGL00770:Ubr5	APN	15	38006541	missense	probably benign	0.27
IGL00774:Ubr5	APN	15	38006541	missense	probably benign	0.27
IGL00919:Ubr5	APN	15	38040842	missense	probably damaging	1.00
IGL00962:Ubr5	APN	15	37985934	missense	probably damaging	1.00
IGL01328:Ubr5	APN	15	37981523	missense	possibly damaging	0.82
IGL01359:Ubr5	APN	15	37973006	missense	probably damaging	0.96
IGL01394:Ubr5	APN	15	38009631	missense	possibly damaging	0.90
IGL01674:Ubr5	APN	15	37998379	missense	probably damaging	1.00
IGL01981:Ubr5	APN	15	37996598	missense	probably benign	0.08
IGL01993:Ubr5	APN	15	37973012	missense	probably damaging	0.99
IGL02159:Ubr5	APN	15	37991379	splice site	probably benign
IGL02252:Ubr5	APN	15	38024894	missense	probably damaging	1.00
IGL02442:Ubr5	APN	15	38037901	missense	possibly damaging	0.95
IGL02502:Ubr5	APN	15	38030689	missense	probably benign	0.01
IGL02503:Ubr5	APN	15	38018320	missense	possibly damaging	0.90
IGL02503:Ubr5	APN	15	38018314	missense	probably damaging	0.99
IGL02546:Ubr5	APN	15	38008747	missense	probably benign	0.00
IGL02556:Ubr5	APN	15	38002448	missense	probably benign	0.18
IGL02647:Ubr5	APN	15	37992082	missense	probably damaging	0.99
IGL02679:Ubr5	APN	15	38002314	missense	probably benign	0.36
IGL02726:Ubr5	APN	15	38000562	splice site	probably benign
IGL02884:Ubr5	APN	15	37998376	missense	probably damaging	1.00
IGL02972:Ubr5	APN	15	38041952	missense	probably damaging	1.00
IGL03000:Ubr5	APN	15	38024852	missense	probably damaging	0.99
IGL03028:Ubr5	APN	15	38047593	missense	probably benign	0.00
IGL03057:Ubr5	APN	15	38040906	splice site	probably benign
IGL03085:Ubr5	APN	15	38029568	missense	probably damaging	1.00
IGL03198:Ubr5	APN	15	38045720	missense	probably damaging	1.00
IGL03368:Ubr5	APN	15	37998316	missense	probably damaging	0.96
Anchovy	UTSW	15	37979832	missense	probably null
P0016:Ubr5	UTSW	15	38000578	missense	probably damaging	1.00
PIT4142001:Ubr5	UTSW	15	38041909	missense	probably damaging	0.98
R0133:Ubr5	UTSW	15	37996571	missense	probably damaging	0.98
R0173:Ubr5	UTSW	15	38004675	missense	probably damaging	1.00
R0234:Ubr5	UTSW	15	37968493	missense	probably damaging	1.00
R0234:Ubr5	UTSW	15	37968493	missense	probably damaging	1.00
R0314:Ubr5	UTSW	15	37997187	missense	probably damaging	0.99
R0379:Ubr5	UTSW	15	38018957	missense	probably benign	0.00
R0390:Ubr5	UTSW	15	38030672	missense	probably benign	0.19
R0415:Ubr5	UTSW	15	37972980	missense	probably damaging	0.98
R0531:Ubr5	UTSW	15	37991344	missense	probably benign	0.34
R0650:Ubr5	UTSW	15	38030807	splice site	probably benign
R0720:Ubr5	UTSW	15	37972991	missense	probably damaging	0.98
R1183:Ubr5	UTSW	15	37997175	missense	possibly damaging	0.71
R1302:Ubr5	UTSW	15	38041479	missense	possibly damaging	0.91
R1442:Ubr5	UTSW	15	38014924	splice site	probably benign
R1507:Ubr5	UTSW	15	37980870	missense	probably damaging	1.00
R1575:Ubr5	UTSW	15	38040841	missense	probably damaging	1.00
R1577:Ubr5	UTSW	15	38030730	missense	possibly damaging	0.76
R1622:Ubr5	UTSW	15	38009113	unclassified	probably benign
R1721:Ubr5	UTSW	15	38041846	missense	probably benign	0.18
R1799:Ubr5	UTSW	15	37989377	missense	probably damaging	1.00
R1840:Ubr5	UTSW	15	37980917	missense	possibly damaging	0.51
R1867:Ubr5	UTSW	15	38041846	missense	probably benign	0.18
R1868:Ubr5	UTSW	15	38041846	missense	probably benign	0.18
R2065:Ubr5	UTSW	15	38040842	missense	probably damaging	1.00
R2107:Ubr5	UTSW	15	37989302	missense	probably benign	0.00
R2201:Ubr5	UTSW	15	38002299	missense	possibly damaging	0.83
R2261:Ubr5	UTSW	15	37988284	missense	probably damaging	0.99
R2441:Ubr5	UTSW	15	37989345	missense	probably damaging	0.99
R2512:Ubr5	UTSW	15	38002319	missense	probably damaging	1.00
R3008:Ubr5	UTSW	15	38030845	missense	probably benign
R3412:Ubr5	UTSW	15	38004235	splice site	probably benign
R3898:Ubr5	UTSW	15	37997739	missense	probably benign	0.02
R3900:Ubr5	UTSW	15	38019242	missense	probably damaging	1.00
R4032:Ubr5	UTSW	15	38024837	missense
R4352:Ubr5	UTSW	15	38041573	missense	probably benign	0.31
R4362:Ubr5	UTSW	15	38078403	missense	probably damaging	0.99
R4507:Ubr5	UTSW	15	38013542	missense	probably damaging	0.96
R4683:Ubr5	UTSW	15	38037967	missense	probably damaging	1.00
R4771:Ubr5	UTSW	15	38018297	missense	possibly damaging	0.50
R4878:Ubr5	UTSW	15	38006564	missense	probably benign	0.01
R4999:Ubr5	UTSW	15	38009668	missense	probably benign	0.06
R5057:Ubr5	UTSW	15	38004109	missense	probably damaging	0.98
R5177:Ubr5	UTSW	15	38006517	missense	probably benign	0.22
R5186:Ubr5	UTSW	15	37997916	missense	probably damaging	0.99
R5378:Ubr5	UTSW	15	37989578	missense	probably damaging	1.00
R5486:Ubr5	UTSW	15	38008739	missense	probably benign	0.00
R5494:Ubr5	UTSW	15	38019281	missense	possibly damaging	0.78
R5617:Ubr5	UTSW	15	38030657	missense	possibly damaging	0.47
R5636:Ubr5	UTSW	15	37983996	missense	probably damaging	1.00
R5655:Ubr5	UTSW	15	38015093	missense	probably damaging	0.99
R5715:Ubr5	UTSW	15	38002233	missense	probably benign	0.06
R5781:Ubr5	UTSW	15	38006541	missense	probably benign	0.27
R6645:Ubr5	UTSW	15	38029506	missense	probably damaging	1.00
R6774:Ubr5	UTSW	15	38015135	missense	probably damaging	1.00
R6823:Ubr5	UTSW	15	37989598	missense	probably benign	0.08
R6877:Ubr5	UTSW	15	38002570	missense	probably damaging	0.98
R7105:Ubr5	UTSW	15	38008775	missense
R7166:Ubr5	UTSW	15	37976145	missense
R7514:Ubr5	UTSW	15	37988237	missense
R7523:Ubr5	UTSW	15	38004055	missense
R7631:Ubr5	UTSW	15	38029507	missense
R7709:Ubr5	UTSW	15	37979832	missense	probably null
R7710:Ubr5	UTSW	15	37979832	missense	probably null
R7712:Ubr5	UTSW	15	37979832	missense	probably null
R7803:Ubr5	UTSW	15	37979832	missense	probably null
R7816:Ubr5	UTSW	15	37979832	missense	probably null
R7817:Ubr5	UTSW	15	37979832	missense	probably null
R7821:Ubr5	UTSW	15	37997187	missense	probably damaging	0.96
R7824:Ubr5	UTSW	15	37991322	missense	probably damaging	0.97
R7841:Ubr5	UTSW	15	37980906	missense
R7869:Ubr5	UTSW	15	37979832	missense	probably null
R7896:Ubr5	UTSW	15	38041573	missense	probably benign	0.31
R8191:Ubr5	UTSW	15	38006507	missense
R8342:Ubr5	UTSW	15	38024837	missense
RF024:Ubr5	UTSW	15	38028652	missense
X0024:Ubr5	UTSW	15	37992060	missense	probably damaging	1.00
Z1177:Ubr5	UTSW	15	38040755	missense

Predicted Primers

PCR Primer
(F):5'- AGTCATGGTCAGGCATATCTGAATC -3'
(R):5'- TGGTCACCCTACCAAACAGTAG -3'

Sequencing Primer
(F):5'- GTCAGGCATATCTGAATCTAAAAAGG -3'
(R):5'- CTACCAAACAGTAGGCAAGTAGAATG -3'

Posted On

2015-07-21