Incidental Mutation 'R4467:Has1'
ID329255
Institutional Source Beutler Lab
Gene Symbol Has1
Ensembl Gene ENSMUSG00000003665
Gene Namehyaluronan synthase 1
Synonyms
MMRRC Submission 041724-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4467 (G1)
Quality Score218
Status Validated
Chromosome17
Chromosomal Location17843323-17855205 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 17843995 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 461 (V461M)
Ref Sequence ENSEMBL: ENSMUSP00000003762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003762] [ENSMUST00000139969] [ENSMUST00000172097] [ENSMUST00000226899]
Predicted Effect probably benign
Transcript: ENSMUST00000003762
AA Change: V461M

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000003762
Gene: ENSMUSG00000003665
AA Change: V461M

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
low complexity region 78 86 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 179 387 1.1e-21 PFAM
Pfam:Glyco_transf_21 205 386 1.2e-8 PFAM
Pfam:Chitin_synth_2 222 394 1.6e-16 PFAM
Pfam:Glyco_trans_2_3 237 453 5.6e-16 PFAM
transmembrane domain 464 486 N/A INTRINSIC
transmembrane domain 501 523 N/A INTRINSIC
transmembrane domain 544 566 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000052338
Predicted Effect probably benign
Transcript: ENSMUST00000139969
SMART Domains Protein: ENSMUSP00000119658
Gene: ENSMUSG00000080316

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Blast:IG 151 186 1e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154301
SMART Domains Protein: ENSMUSP00000117377
Gene: ENSMUSG00000080316

DomainStartEndE-ValueType
Blast:IG 27 78 2e-32 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172097
SMART Domains Protein: ENSMUSP00000128732
Gene: ENSMUSG00000080316

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
IG 171 260 2.08e-1 SMART
transmembrane domain 310 332 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179350
Predicted Effect probably benign
Transcript: ENSMUST00000226899
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232410
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hyaluronan or hyaluronic acid (HA) is a high molecular weight unbranched polysaccharide synthesized by a wide variety of organisms from bacteria to mammals, and is a constituent of the extracellular matrix. It consists of alternating glucuronic acid and N-acetylglucosamine residues that are linked by beta-1-3 and beta-1-4 glycosidic bonds. HA is synthesized by membrane-bound synthase at the inner surface of the plasma membrane, and the chains are extruded through pore-like structures into the extracellular space. It serves a variety of functions, including space filling, lubrication of joints, and provision of a matrix through which cells can migrate. HA is actively produced during wound healing and tissue repair to provide a framework for ingrowth of blood vessels and fibroblasts. Changes in the serum concentration of HA are associated with inflammatory and degenerative arthropathies such as rheumatoid arthritis. In addition, the interaction of HA with the leukocyte receptor CD44 is important in tissue-specific homing by leukocytes, and overexpression of HA receptors has been correlated with tumor metastasis. HAS1 is a member of the newly identified vertebrate gene family encoding putative hyaluronan synthases, and its amino acid sequence shows significant homology to the hasA gene product of Streptococcus pyogenes, a glycosaminoglycan synthetase (DG42) from Xenopus laevis, and a recently described murine hyaluronan synthase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and appear grossly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
4930402H24Rik A G 2: 130,767,647 I372T probably damaging Het
Atg4a-ps A G 3: 103,645,855 Y57H probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bms1 G A 6: 118,383,847 T1220I probably damaging Het
Brat1 T C 5: 140,705,071 probably benign Het
Casc1 A T 6: 145,183,218 probably null Het
Cds2 T A 2: 132,294,446 Y39* probably null Het
Chrnd T A 1: 87,197,377 L384Q probably damaging Het
Cpa3 A T 3: 20,228,817 Y155* probably null Het
Crlf1 G A 8: 70,500,956 W260* probably null Het
Cux1 C G 5: 136,312,722 E605D probably damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Dmtf1 T C 5: 9,136,085 N167S probably damaging Het
Dtx2 T A 5: 136,012,076 W112R probably damaging Het
Elf3 A G 1: 135,256,844 I138T probably damaging Het
F11 T A 8: 45,241,474 I617F probably damaging Het
Fdps A T 3: 89,100,786 D8E possibly damaging Het
Fzd10 C A 5: 128,601,276 T20K probably benign Het
Gm9978 T A 10: 78,486,916 noncoding transcript Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Hdac3 C T 18: 37,952,513 G80D probably benign Het
Klk12 A T 7: 43,773,383 R245W probably damaging Het
Lamp5 A G 2: 136,059,020 I47V probably damaging Het
Olfr786 T C 10: 129,437,064 I84T probably benign Het
Ovgp1 A G 3: 105,977,711 D122G probably benign Het
Piezo1 T C 8: 122,486,396 E1875G probably benign Het
Pih1d1 A G 7: 45,158,497 M132V possibly damaging Het
Pon2 C T 6: 5,267,021 A241T probably benign Het
Prkce A G 17: 86,619,911 I538V possibly damaging Het
Rab36 C T 10: 75,052,043 R249* probably null Het
Rps6kl1 C T 12: 85,147,808 A110T probably damaging Het
Rsad1 T C 11: 94,544,530 T244A probably benign Het
Slc22a7 T C 17: 46,432,510 I532V probably benign Het
Slc2a7 T C 4: 150,163,274 V377A possibly damaging Het
Slx4 A G 16: 3,989,055 V508A possibly damaging Het
Stag2 A G X: 42,233,872 S400G probably benign Het
Stat6 T G 10: 127,651,228 I201M probably damaging Het
Stim2 T C 5: 54,116,194 probably null Het
Tbc1d9 A G 8: 83,210,478 Y63C probably damaging Het
Tctn2 T C 5: 124,620,189 noncoding transcript Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ubr5 T A 15: 38,004,336 T1282S probably damaging Het
Ufl1 A T 4: 25,254,806 I550N probably damaging Het
Uty A G Y: 1,158,372 V557A possibly damaging Het
Vmn1r54 T C 6: 90,269,271 S56P probably damaging Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Has1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Has1 APN 17 17843662 unclassified probably benign
IGL02551:Has1 APN 17 17848298 missense probably damaging 1.00
R0149:Has1 UTSW 17 17850171 missense probably damaging 1.00
R0496:Has1 UTSW 17 17843746 missense probably benign
R0637:Has1 UTSW 17 17843863 missense possibly damaging 0.67
R1051:Has1 UTSW 17 17848279 missense probably damaging 1.00
R1647:Has1 UTSW 17 17849985 missense probably damaging 1.00
R1648:Has1 UTSW 17 17849985 missense probably damaging 1.00
R1768:Has1 UTSW 17 17850300 missense probably benign
R2016:Has1 UTSW 17 17848270 missense probably damaging 1.00
R3810:Has1 UTSW 17 17847560 missense probably damaging 0.98
R4235:Has1 UTSW 17 17850036 missense possibly damaging 0.62
R5475:Has1 UTSW 17 17848321 missense possibly damaging 0.57
R5682:Has1 UTSW 17 17844163 missense possibly damaging 0.58
R6418:Has1 UTSW 17 17849945 missense probably damaging 1.00
R6841:Has1 UTSW 17 17843860 missense probably benign 0.06
R7076:Has1 UTSW 17 17843806 missense probably damaging 1.00
R7767:Has1 UTSW 17 17850530 missense probably damaging 1.00
R8878:Has1 UTSW 17 17850059 missense possibly damaging 0.57
X0028:Has1 UTSW 17 17850453 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCAAGGTGGTAGGCTTCAG -3'
(R):5'- GCATGGATGACCTATGAAGCGG -3'

Sequencing Primer
(F):5'- GCCTCCAAGCAGCAGTAGAG -3'
(R):5'- ACCTATGAAGCGGTGGTCTC -3'
Posted On2015-07-21