Incidental Mutation 'R4467:Prkce'
ID329257
Institutional Source Beutler Lab
Gene Symbol Prkce
Ensembl Gene ENSMUSG00000045038
Gene Nameprotein kinase C, epsilon
SynonymsPkce, PKCepsilon, PKC[e], 5830406C15Rik
MMRRC Submission 041724-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4467 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location86167785-86657919 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86619911 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 538 (I538V)
Ref Sequence ENSEMBL: ENSMUSP00000094874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097274] [ENSMUST00000097275]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097274
AA Change: I538V

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000094873
Gene: ENSMUSG00000045038
AA Change: I538V

DomainStartEndE-ValueType
C2 7 114 5.78e-12 SMART
C1 170 220 4.48e-13 SMART
C1 243 292 8.29e-17 SMART
S_TKc 408 668 1.3e-104 SMART
S_TK_X 669 732 2.56e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000097275
AA Change: I538V

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000094874
Gene: ENSMUSG00000045038
AA Change: I538V

DomainStartEndE-ValueType
C2 7 114 5.78e-12 SMART
C1 170 220 4.48e-13 SMART
C1 243 292 8.29e-17 SMART
S_TKc 408 668 1.3e-104 SMART
S_TK_X 669 732 2.56e-25 SMART
Meta Mutation Damage Score 0.1948 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been shown to be involved in many different cellular functions, such as neuron channel activation, apoptosis, cardioprotection from ischemia, heat shock response, as well as insulin exocytosis. Knockout studies in mice suggest that this kinase is important for lipopolysaccharide (LPS)-mediated signaling in activated macrophages and may also play a role in controlling anxiety-like behavior. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced ethanol self-administration and are more sensitive to the acute behavioral effects of ethanol and other drugs that activate GABA(A) receptors. Mutants show reduced anxiety and stress hormones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
4930402H24Rik A G 2: 130,767,647 I372T probably damaging Het
Atg4a-ps A G 3: 103,645,855 Y57H probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bms1 G A 6: 118,383,847 T1220I probably damaging Het
Brat1 T C 5: 140,705,071 probably benign Het
Casc1 A T 6: 145,183,218 probably null Het
Cds2 T A 2: 132,294,446 Y39* probably null Het
Chrnd T A 1: 87,197,377 L384Q probably damaging Het
Cpa3 A T 3: 20,228,817 Y155* probably null Het
Crlf1 G A 8: 70,500,956 W260* probably null Het
Cux1 C G 5: 136,312,722 E605D probably damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Dmtf1 T C 5: 9,136,085 N167S probably damaging Het
Dtx2 T A 5: 136,012,076 W112R probably damaging Het
Elf3 A G 1: 135,256,844 I138T probably damaging Het
F11 T A 8: 45,241,474 I617F probably damaging Het
Fdps A T 3: 89,100,786 D8E possibly damaging Het
Fzd10 C A 5: 128,601,276 T20K probably benign Het
Gm9978 T A 10: 78,486,916 noncoding transcript Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Has1 C T 17: 17,843,995 V461M probably benign Het
Hdac3 C T 18: 37,952,513 G80D probably benign Het
Klk12 A T 7: 43,773,383 R245W probably damaging Het
Lamp5 A G 2: 136,059,020 I47V probably damaging Het
Olfr786 T C 10: 129,437,064 I84T probably benign Het
Ovgp1 A G 3: 105,977,711 D122G probably benign Het
Piezo1 T C 8: 122,486,396 E1875G probably benign Het
Pih1d1 A G 7: 45,158,497 M132V possibly damaging Het
Pon2 C T 6: 5,267,021 A241T probably benign Het
Rab36 C T 10: 75,052,043 R249* probably null Het
Rps6kl1 C T 12: 85,147,808 A110T probably damaging Het
Rsad1 T C 11: 94,544,530 T244A probably benign Het
Slc22a7 T C 17: 46,432,510 I532V probably benign Het
Slc2a7 T C 4: 150,163,274 V377A possibly damaging Het
Slx4 A G 16: 3,989,055 V508A possibly damaging Het
Stag2 A G X: 42,233,872 S400G probably benign Het
Stat6 T G 10: 127,651,228 I201M probably damaging Het
Stim2 T C 5: 54,116,194 probably null Het
Tbc1d9 A G 8: 83,210,478 Y63C probably damaging Het
Tctn2 T C 5: 124,620,189 noncoding transcript Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ubr5 T A 15: 38,004,336 T1282S probably damaging Het
Ufl1 A T 4: 25,254,806 I550N probably damaging Het
Uty A G Y: 1,158,372 V557A possibly damaging Het
Vmn1r54 T C 6: 90,269,271 S56P probably damaging Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Prkce
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Prkce APN 17 86625462 missense probably damaging 0.99
IGL01401:Prkce APN 17 86168840 missense probably damaging 1.00
IGL01508:Prkce APN 17 86630085 missense probably damaging 1.00
IGL02500:Prkce APN 17 86168914 missense probably benign 0.16
IGL02957:Prkce APN 17 86496026 missense possibly damaging 0.74
IGL03114:Prkce APN 17 86654555 missense probably damaging 0.97
Pinnacles UTSW 17 86476851 missense probably damaging 1.00
R0063:Prkce UTSW 17 86482111 splice site probably benign
R0063:Prkce UTSW 17 86482111 splice site probably benign
R0403:Prkce UTSW 17 86168653 missense probably damaging 0.98
R0900:Prkce UTSW 17 86625458 missense probably damaging 1.00
R0919:Prkce UTSW 17 86630160 missense probably benign 0.06
R1413:Prkce UTSW 17 86496018 missense possibly damaging 0.81
R1430:Prkce UTSW 17 86559137 splice site probably benign
R1843:Prkce UTSW 17 86475546 nonsense probably null
R2129:Prkce UTSW 17 86496035 missense possibly damaging 0.89
R2341:Prkce UTSW 17 86474442 missense probably damaging 1.00
R2511:Prkce UTSW 17 86625326 missense probably damaging 1.00
R2679:Prkce UTSW 17 86176226 intron probably benign
R3724:Prkce UTSW 17 86168623 nonsense probably null
R3853:Prkce UTSW 17 86168849 missense probably damaging 1.00
R4364:Prkce UTSW 17 86476851 missense probably damaging 1.00
R4523:Prkce UTSW 17 86490750 critical splice acceptor site probably null
R4838:Prkce UTSW 17 86630083 missense probably benign 0.07
R5140:Prkce UTSW 17 86482142 missense probably benign 0.12
R5579:Prkce UTSW 17 86619948 missense probably damaging 1.00
R6026:Prkce UTSW 17 86493230 missense probably benign 0.02
R6048:Prkce UTSW 17 86493347 missense probably benign
R6212:Prkce UTSW 17 86559301 missense probably damaging 1.00
R6484:Prkce UTSW 17 86490809 missense probably benign
R6788:Prkce UTSW 17 86630061 missense probably damaging 1.00
R6915:Prkce UTSW 17 86493407 missense probably damaging 1.00
R7349:Prkce UTSW 17 86493355 missense probably benign
R7447:Prkce UTSW 17 86559259 missense probably damaging 1.00
R7566:Prkce UTSW 17 86493329 missense probably benign 0.00
R7577:Prkce UTSW 17 86493293 nonsense probably null
R7638:Prkce UTSW 17 86168600 missense probably benign 0.26
R8237:Prkce UTSW 17 86559218 missense probably damaging 1.00
R8711:Prkce UTSW 17 86488197 missense probably damaging 1.00
R8869:Prkce UTSW 17 86168942 critical splice donor site probably null
RF010:Prkce UTSW 17 86488199 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGCAGGATCCTGTCTTTTGC -3'
(R):5'- TCTCTGTTCTGACGCTAAGAGAG -3'

Sequencing Primer
(F):5'- AAATGCTGTTGAAGGTTGTCCAGC -3'
(R):5'- GAGAAGCTAACTCTGCACGTG -3'
Posted On2015-07-21