Incidental Mutation 'R4468:Ccdc33'
ID329279
Institutional Source Beutler Lab
Gene Symbol Ccdc33
Ensembl Gene ENSMUSG00000037716
Gene Namecoiled-coil domain containing 33
SynonymsLOC382077, 4930535E21Rik
MMRRC Submission 041725-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4468 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location58028677-58118823 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 58069872 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 282 (T282K)
Ref Sequence ENSEMBL: ENSMUSP00000112613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042205] [ENSMUST00000098682] [ENSMUST00000119665] [ENSMUST00000215944]
Predicted Effect probably benign
Transcript: ENSMUST00000042205
AA Change: T282K

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000040899
Gene: ENSMUSG00000037716
AA Change: T282K

DomainStartEndE-ValueType
C2 36 140 5.79e-3 SMART
coiled coil region 413 451 N/A INTRINSIC
coiled coil region 472 560 N/A INTRINSIC
coiled coil region 630 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098682
AA Change: T491K

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000096279
Gene: ENSMUSG00000037716
AA Change: T491K

DomainStartEndE-ValueType
C2 281 385 5.79e-3 SMART
coiled coil region 598 636 N/A INTRINSIC
coiled coil region 657 745 N/A INTRINSIC
coiled coil region 884 922 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119665
AA Change: T282K

PolyPhen 2 Score 0.666 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112613
Gene: ENSMUSG00000037716
AA Change: T282K

DomainStartEndE-ValueType
C2 36 140 5.79e-3 SMART
coiled coil region 413 559 N/A INTRINSIC
coiled coil region 629 667 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146741
Predicted Effect probably benign
Transcript: ENSMUST00000215944
AA Change: T491K

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.158 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aanat A T 11: 116,596,955 D160V possibly damaging Het
Abca2 A G 2: 25,444,902 Y1962C probably damaging Het
Adgrv1 T A 13: 81,374,256 M5921L probably benign Het
Bmp2 T C 2: 133,554,454 V10A probably benign Het
Chd1 T C 17: 15,760,395 I1308T probably damaging Het
Clec4f A G 6: 83,652,433 I381T probably damaging Het
Fam213b T G 4: 154,897,050 K190T probably benign Het
Ifit1bl2 G A 19: 34,619,068 Q383* probably null Het
Igkv6-15 A G 6: 70,406,973 V7A probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lancl2 T A 6: 57,713,034 L75H probably damaging Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Mum1 C T 10: 80,240,736 probably benign Het
Olfr104-ps A G 17: 37,362,637 I170M possibly damaging Het
Olfr155 G A 4: 43,854,737 V143M probably benign Het
Olfr847 C T 9: 19,375,648 V78I probably benign Het
Pcdha5 T C 18: 36,962,180 S581P probably benign Het
Phf10 T C 17: 14,952,775 probably null Het
Ppp2r3c C T 12: 55,297,883 W100* probably null Het
Rad9a G A 19: 4,200,294 H143Y probably benign Het
Riox2 T A 16: 59,475,994 probably benign Het
Ros1 T A 10: 52,118,356 Y1276F probably damaging Het
Rps12-ps24 A G 8: 36,026,114 noncoding transcript Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Scn11a G A 9: 119,754,987 L1521F probably damaging Het
Shoc2 A G 19: 54,026,414 Y346C probably damaging Het
Skp1a C T 11: 52,245,078 T138I probably benign Het
Snx29 T A 16: 11,420,701 probably null Het
Sos1 A G 17: 80,453,811 I152T probably damaging Het
Spag17 A T 3: 100,085,366 D1726V probably damaging Het
Tns4 A T 11: 99,070,415 C646S probably benign Het
Txndc11 T C 16: 11,075,223 H881R probably benign Het
Wls C A 3: 159,872,927 A42E probably damaging Het
Other mutations in Ccdc33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Ccdc33 APN 9 58069974 splice site probably benign
IGL01403:Ccdc33 APN 9 58117385 missense probably damaging 1.00
IGL01411:Ccdc33 APN 9 58117636 splice site probably benign
IGL01714:Ccdc33 APN 9 58029870 missense possibly damaging 0.91
IGL02028:Ccdc33 APN 9 58076578 missense probably benign 0.13
IGL02158:Ccdc33 APN 9 58030419 missense probably damaging 0.99
IGL02174:Ccdc33 APN 9 58033655 missense probably benign 0.45
IGL02805:Ccdc33 APN 9 58098591 missense probably benign 0.43
R0276:Ccdc33 UTSW 9 58058392 missense probably damaging 0.99
R0537:Ccdc33 UTSW 9 58117454 missense probably damaging 1.00
R0737:Ccdc33 UTSW 9 58082048 missense probably damaging 0.99
R0789:Ccdc33 UTSW 9 58117214 splice site probably benign
R0791:Ccdc33 UTSW 9 58028763 missense possibly damaging 0.66
R0920:Ccdc33 UTSW 9 58033672 missense probably damaging 0.99
R1541:Ccdc33 UTSW 9 58117466 missense probably damaging 0.99
R1759:Ccdc33 UTSW 9 58117446 missense possibly damaging 0.84
R1857:Ccdc33 UTSW 9 58032708 missense possibly damaging 0.66
R1976:Ccdc33 UTSW 9 58117162 nonsense probably null
R1982:Ccdc33 UTSW 9 58117168 missense probably benign 0.07
R2044:Ccdc33 UTSW 9 58031112 missense possibly damaging 0.93
R2224:Ccdc33 UTSW 9 58082022 missense probably damaging 1.00
R2225:Ccdc33 UTSW 9 58082022 missense probably damaging 1.00
R2227:Ccdc33 UTSW 9 58082022 missense probably damaging 1.00
R2369:Ccdc33 UTSW 9 58076630 missense probably benign 0.44
R3899:Ccdc33 UTSW 9 58032917 missense probably damaging 0.99
R4468:Ccdc33 UTSW 9 58029952 missense possibly damaging 0.93
R4703:Ccdc33 UTSW 9 58033670 missense possibly damaging 0.86
R4705:Ccdc33 UTSW 9 58117557 missense probably benign 0.01
R4790:Ccdc33 UTSW 9 58029957 missense probably damaging 0.96
R4817:Ccdc33 UTSW 9 58067535 missense probably damaging 0.98
R4879:Ccdc33 UTSW 9 58067556 missense possibly damaging 0.86
R4931:Ccdc33 UTSW 9 58069851 missense probably damaging 1.00
R5015:Ccdc33 UTSW 9 58118635 missense probably damaging 1.00
R5223:Ccdc33 UTSW 9 58032984 missense possibly damaging 0.91
R5327:Ccdc33 UTSW 9 58086577 missense probably benign 0.00
R5528:Ccdc33 UTSW 9 58028795 missense probably benign 0.06
R5534:Ccdc33 UTSW 9 58117167 missense possibly damaging 0.83
R5786:Ccdc33 UTSW 9 58029952 missense possibly damaging 0.93
R5844:Ccdc33 UTSW 9 58033206 splice site probably benign
R5975:Ccdc33 UTSW 9 58117478 missense possibly damaging 0.49
R6120:Ccdc33 UTSW 9 58086600 missense probably damaging 1.00
R6256:Ccdc33 UTSW 9 58101918 splice site probably null
R6363:Ccdc33 UTSW 9 58114335 missense probably benign 0.00
R6610:Ccdc33 UTSW 9 58069136 missense possibly damaging 0.66
R6767:Ccdc33 UTSW 9 58033244 missense possibly damaging 0.96
R7072:Ccdc33 UTSW 9 58111984 makesense probably null
R7121:Ccdc33 UTSW 9 58080884 missense probably benign 0.00
R7182:Ccdc33 UTSW 9 58034173 intron probably null
R7239:Ccdc33 UTSW 9 58032909 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTATCCAGGTAAGGATTGGC -3'
(R):5'- ACTGAGACAAACACTTGGGGC -3'

Sequencing Primer
(F):5'- TGAGAGTCCTGGCCTATGCTC -3'
(R):5'- GGCAAGTAAGAGACACATGTACAACC -3'
Posted On2015-07-21