Incidental Mutation 'R4468:Txndc11'
ID329288
Institutional Source Beutler Lab
Gene Symbol Txndc11
Ensembl Gene ENSMUSG00000022498
Gene Namethioredoxin domain containing 11
Synonyms2810408E11Rik, EF-hand binding protein 1, Txdc11, EFP1
MMRRC Submission 041725-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R4468 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location11074911-11134650 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11075223 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 881 (H881R)
Ref Sequence ENSEMBL: ENSMUSP00000041113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038424] [ENSMUST00000089011] [ENSMUST00000228962]
Predicted Effect probably benign
Transcript: ENSMUST00000038424
AA Change: H881R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000041113
Gene: ENSMUSG00000022498
AA Change: H881R

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 61 76 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
Pfam:Thioredoxin 107 208 5.8e-11 PFAM
Pfam:Thioredoxin 660 756 1e-11 PFAM
coiled coil region 793 830 N/A INTRINSIC
low complexity region 927 936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089011
SMART Domains Protein: ENSMUSP00000086405
Gene: ENSMUSG00000037972

DomainStartEndE-ValueType
Pfam:SNN_transmemb 1 33 1.8e-28 PFAM
Pfam:SNN_linker 34 59 2.7e-25 PFAM
Pfam:SNN_cytoplasm 61 87 3.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148183
Predicted Effect probably benign
Transcript: ENSMUST00000228962
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aanat A T 11: 116,596,955 D160V possibly damaging Het
Abca2 A G 2: 25,444,902 Y1962C probably damaging Het
Adgrv1 T A 13: 81,374,256 M5921L probably benign Het
Bmp2 T C 2: 133,554,454 V10A probably benign Het
Ccdc33 A G 9: 58,029,952 S655P possibly damaging Het
Ccdc33 G T 9: 58,069,872 T282K possibly damaging Het
Chd1 T C 17: 15,760,395 I1308T probably damaging Het
Clec4f A G 6: 83,652,433 I381T probably damaging Het
Fam213b T G 4: 154,897,050 K190T probably benign Het
Ifit1bl2 G A 19: 34,619,068 Q383* probably null Het
Igkv6-15 A G 6: 70,406,973 V7A probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lancl2 T A 6: 57,713,034 L75H probably damaging Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Mum1 C T 10: 80,240,736 probably benign Het
Olfr104-ps A G 17: 37,362,637 I170M possibly damaging Het
Olfr155 G A 4: 43,854,737 V143M probably benign Het
Olfr847 C T 9: 19,375,648 V78I probably benign Het
Pcdha5 T C 18: 36,962,180 S581P probably benign Het
Phf10 T C 17: 14,952,775 probably null Het
Ppp2r3c C T 12: 55,297,883 W100* probably null Het
Rad9a G A 19: 4,200,294 H143Y probably benign Het
Riox2 T A 16: 59,475,994 probably benign Het
Ros1 T A 10: 52,118,356 Y1276F probably damaging Het
Rps12-ps24 A G 8: 36,026,114 noncoding transcript Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Scn11a G A 9: 119,754,987 L1521F probably damaging Het
Shoc2 A G 19: 54,026,414 Y346C probably damaging Het
Skp1a C T 11: 52,245,078 T138I probably benign Het
Snx29 T A 16: 11,420,701 probably null Het
Sos1 A G 17: 80,453,811 I152T probably damaging Het
Spag17 A T 3: 100,085,366 D1726V probably damaging Het
Tns4 A T 11: 99,070,415 C646S probably benign Het
Wls C A 3: 159,872,927 A42E probably damaging Het
Other mutations in Txndc11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Txndc11 APN 16 11104632 missense probably damaging 0.96
IGL00563:Txndc11 APN 16 11104632 missense probably damaging 0.96
IGL02576:Txndc11 APN 16 11075017 unclassified probably benign
IGL03070:Txndc11 APN 16 11075287 missense probably damaging 0.97
P0047:Txndc11 UTSW 16 11091797 splice site probably benign
R0091:Txndc11 UTSW 16 11088104 missense probably benign
R0448:Txndc11 UTSW 16 11091761 missense probably damaging 0.99
R0796:Txndc11 UTSW 16 11134474 small deletion probably benign
R0960:Txndc11 UTSW 16 11091589 missense probably benign 0.28
R1184:Txndc11 UTSW 16 11128500 missense probably benign 0.03
R1327:Txndc11 UTSW 16 11116814 missense possibly damaging 0.86
R1441:Txndc11 UTSW 16 11134550 start gained probably benign
R1515:Txndc11 UTSW 16 11075062 missense probably damaging 0.98
R1699:Txndc11 UTSW 16 11087775 critical splice donor site probably null
R1709:Txndc11 UTSW 16 11128701 nonsense probably null
R1850:Txndc11 UTSW 16 11088404 missense probably damaging 0.98
R2026:Txndc11 UTSW 16 11134474 small deletion probably benign
R3433:Txndc11 UTSW 16 11088188 missense probably benign
R4469:Txndc11 UTSW 16 11075223 missense probably benign 0.01
R4652:Txndc11 UTSW 16 11075122 missense probably benign
R4675:Txndc11 UTSW 16 11084881 missense possibly damaging 0.65
R4697:Txndc11 UTSW 16 11084314 missense probably damaging 0.99
R4907:Txndc11 UTSW 16 11088534 missense probably benign 0.17
R5205:Txndc11 UTSW 16 11128665 missense probably damaging 0.98
R5273:Txndc11 UTSW 16 11128623 missense probably benign 0.07
R5865:Txndc11 UTSW 16 11122688 missense probably damaging 1.00
R5873:Txndc11 UTSW 16 11075205 missense probably damaging 1.00
R5941:Txndc11 UTSW 16 11075071 missense probably benign 0.04
R6360:Txndc11 UTSW 16 11084792 missense probably damaging 1.00
R6894:Txndc11 UTSW 16 11088145 missense probably damaging 1.00
R7285:Txndc11 UTSW 16 11084299 missense probably damaging 0.98
R7334:Txndc11 UTSW 16 11128561 missense probably damaging 1.00
R7502:Txndc11 UTSW 16 11087878 missense probably benign 0.08
R7660:Txndc11 UTSW 16 11087929 missense probably damaging 1.00
R7677:Txndc11 UTSW 16 11134474 small deletion probably benign
R7683:Txndc11 UTSW 16 11084235 missense probably damaging 1.00
R8315:Txndc11 UTSW 16 11075601 missense possibly damaging 0.70
X0020:Txndc11 UTSW 16 11084218 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CGTCTCTGAAGCCAAAGTGGAG -3'
(R):5'- ATCTGAGATGAGCAGCCTACG -3'

Sequencing Primer
(F):5'- CCAAAGTGGAGCTGGTGGTG -3'
(R):5'- TACGCCGTACACAGGAGCAG -3'
Posted On2015-07-21