Mutagenetix > Incidental Mutation

Incidental Mutation 'R4468:Chd1'

329293

Institutional Source

Beutler Lab

Gene Symbol

Chd1

Ensembl Gene

ENSMUSG00000023852

Gene Name

chromodomain helicase DNA binding protein 1

Synonyms

4930525N21Rik

MMRRC Submission

041725-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4468 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

15925229-15992872 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 15980657 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1308 (I1308T)

Ref Sequence

ENSEMBL: ENSMUSP00000024627 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024627]

AlphaFold

P40201

Predicted Effect

probably damaging
Transcript: ENSMUST00000024627
AA Change: I1308T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000024627
Gene: ENSMUSG00000023852
AA Change: I1308T

Domain	Start	End	E-Value	Type
low complexity region	17	67	N/A	INTRINSIC
low complexity region	105	115	N/A	INTRINSIC
low complexity region	116	136	N/A	INTRINSIC
low complexity region	151	175	N/A	INTRINSIC
low complexity region	213	230	N/A	INTRINSIC
CHROMO	268	355	6.43e-20	SMART
CHROMO	385	443	1.19e-14	SMART
DEXDc	475	672	3.44e-34	SMART
Blast:DEXDc	692	786	2e-54	BLAST
low complexity region	787	799	N/A	INTRINSIC
HELICc	816	900	8.48e-25	SMART
Blast:DEXDc	955	1234	1e-112	BLAST
PDB:4B4C\|A	1119	1320	1e-132	PDB
low complexity region	1325	1348	N/A	INTRINSIC
low complexity region	1377	1388	N/A	INTRINSIC
DUF4208	1396	1500	5.54e-51	SMART
low complexity region	1507	1516	N/A	INTRINSIC
low complexity region	1538	1549	N/A	INTRINSIC
low complexity region	1626	1650	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000173040

SMART Domains

Protein: ENSMUSP00000133406
Gene: ENSMUSG00000023852

Domain	Start	End	E-Value	Type
Blast:DEXDc	2	102	5e-58	BLAST
PDB:4B4C\|A	2	153	1e-108	PDB

Meta Mutation Damage Score

0.1728

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.9%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with arrest of epiblast development due to increased apoptosis and cell cycle defects, abnormal rostral-caudal axis patterning, and failure to gastrulate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aanat	A	T	11: 116,487,781 (GRCm39)	D160V	possibly damaging	Het
Abca2	A	G	2: 25,334,914 (GRCm39)	Y1962C	probably damaging	Het
Adgrv1	T	A	13: 81,522,375 (GRCm39)	M5921L	probably benign	Het
Bmp2	T	C	2: 133,396,374 (GRCm39)	V10A	probably benign	Het
Ccdc33	A	G	9: 57,937,235 (GRCm39)	S655P	possibly damaging	Het
Ccdc33	G	T	9: 57,977,155 (GRCm39)	T282K	possibly damaging	Het
Clec4f	A	G	6: 83,629,415 (GRCm39)	I381T	probably damaging	Het
Ifit1bl2	G	A	19: 34,596,468 (GRCm39)	Q383*	probably null	Het
Igkv6-15	A	G	6: 70,383,957 (GRCm39)	V7A	probably benign	Het
Kirrel1	C	T	3: 86,996,458 (GRCm39)	M380I	probably null	Het
Lancl2	T	A	6: 57,690,019 (GRCm39)	L75H	probably damaging	Het
Mtmr11	T	C	3: 96,075,207 (GRCm39)		probably benign	Het
Or12d14-ps1	A	G	17: 37,673,528 (GRCm39)	I170M	possibly damaging	Het
Or13c7	G	A	4: 43,854,737 (GRCm39)	V143M	probably benign	Het
Or7g29	C	T	9: 19,286,944 (GRCm39)	V78I	probably benign	Het
Pcdha5	T	C	18: 37,095,233 (GRCm39)	S581P	probably benign	Het
Phf10	T	C	17: 15,173,037 (GRCm39)		probably null	Het
Ppp2r3c	C	T	12: 55,344,668 (GRCm39)	W100*	probably null	Het
Prxl2b	T	G	4: 154,981,507 (GRCm39)	K190T	probably benign	Het
Pwwp3a	C	T	10: 80,076,570 (GRCm39)		probably benign	Het
Rad9a	G	A	19: 4,250,293 (GRCm39)	H143Y	probably benign	Het
Riox2	T	A	16: 59,296,357 (GRCm39)		probably benign	Het
Ros1	T	A	10: 51,994,452 (GRCm39)	Y1276F	probably damaging	Het
Rps12-ps24	A	G	8: 36,493,268 (GRCm39)		noncoding transcript	Het
Rps6-ps2	A	G	8: 89,533,319 (GRCm39)		noncoding transcript	Het
Scn11a	G	A	9: 119,584,053 (GRCm39)	L1521F	probably damaging	Het
Shoc2	A	G	19: 54,014,845 (GRCm39)	Y346C	probably damaging	Het
Skp1	C	T	11: 52,135,905 (GRCm39)	T138I	probably benign	Het
Snx29	T	A	16: 11,238,565 (GRCm39)		probably null	Het
Sos1	A	G	17: 80,761,240 (GRCm39)	I152T	probably damaging	Het
Spag17	A	T	3: 99,992,682 (GRCm39)	D1726V	probably damaging	Het
Tns4	A	T	11: 98,961,241 (GRCm39)	C646S	probably benign	Het
Txndc11	T	C	16: 10,893,087 (GRCm39)	H881R	probably benign	Het
Wls	C	A	3: 159,578,564 (GRCm39)	A42E	probably damaging	Het

Other mutations in Chd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00704:Chd1	APN	17	15,952,827 (GRCm39)	missense	probably benign	0.37
IGL01356:Chd1	APN	17	15,970,127 (GRCm39)	missense	probably damaging	1.00
IGL01369:Chd1	APN	17	15,975,259 (GRCm39)	missense	probably damaging	0.97
IGL01519:Chd1	APN	17	17,598,831 (GRCm39)	missense	probably damaging	1.00
IGL01604:Chd1	APN	17	15,990,359 (GRCm39)	missense	possibly damaging	0.95
IGL01635:Chd1	APN	17	17,598,858 (GRCm39)	missense	probably damaging	1.00
IGL01721:Chd1	APN	17	15,990,430 (GRCm39)	missense	probably damaging	1.00
IGL01959:Chd1	APN	17	15,962,435 (GRCm39)	missense	probably damaging	1.00
IGL02367:Chd1	APN	17	17,610,315 (GRCm39)	missense	probably damaging	0.98
IGL02476:Chd1	APN	17	15,954,535 (GRCm39)	missense	probably damaging	1.00
IGL02756:Chd1	APN	17	15,951,069 (GRCm39)	missense	probably damaging	0.97
IGL02817:Chd1	APN	17	15,969,762 (GRCm39)	missense	possibly damaging	0.92
IGL03084:Chd1	APN	17	15,990,560 (GRCm39)	missense	probably benign	0.22
IGL03108:Chd1	APN	17	15,945,543 (GRCm39)	missense	possibly damaging	0.70
Holly	UTSW	17	15,946,545 (GRCm39)	missense	possibly damaging	0.72
R0053:Chd1	UTSW	17	15,967,451 (GRCm39)	missense	probably damaging	1.00
R0053:Chd1	UTSW	17	15,967,451 (GRCm39)	missense	probably damaging	1.00
R0128:Chd1	UTSW	17	17,613,829 (GRCm39)	missense	probably damaging	1.00
R0197:Chd1	UTSW	17	15,945,693 (GRCm39)	missense	probably benign
R0285:Chd1	UTSW	17	17,594,942 (GRCm39)	splice site	probably benign
R0326:Chd1	UTSW	17	15,988,830 (GRCm39)	missense	probably benign
R0326:Chd1	UTSW	17	15,988,828 (GRCm39)	missense	probably damaging	1.00
R0372:Chd1	UTSW	17	17,607,552 (GRCm39)	missense	probably benign	0.14
R0391:Chd1	UTSW	17	15,970,156 (GRCm39)	missense	probably damaging	1.00
R0486:Chd1	UTSW	17	15,954,604 (GRCm39)	missense	probably damaging	0.99
R0637:Chd1	UTSW	17	15,962,550 (GRCm39)	missense	possibly damaging	0.50
R0675:Chd1	UTSW	17	15,978,523 (GRCm39)	unclassified	probably benign
R0701:Chd1	UTSW	17	15,945,693 (GRCm39)	missense	probably benign
R0788:Chd1	UTSW	17	15,927,376 (GRCm39)	missense	possibly damaging	0.86
R0848:Chd1	UTSW	17	15,990,503 (GRCm39)	missense	probably damaging	1.00
R0883:Chd1	UTSW	17	15,945,693 (GRCm39)	missense	probably benign
R1169:Chd1	UTSW	17	15,955,994 (GRCm39)	missense	probably damaging	1.00
R1218:Chd1	UTSW	17	15,945,574 (GRCm39)	missense	probably damaging	1.00
R1370:Chd1	UTSW	17	17,607,742 (GRCm39)	missense	probably benign	0.00
R1470:Chd1	UTSW	17	15,946,545 (GRCm39)	missense	possibly damaging	0.72
R1470:Chd1	UTSW	17	15,946,545 (GRCm39)	missense	possibly damaging	0.72
R1478:Chd1	UTSW	17	15,959,769 (GRCm39)	missense	probably damaging	0.99
R1752:Chd1	UTSW	17	15,963,494 (GRCm39)	critical splice donor site	probably null
R1759:Chd1	UTSW	17	17,607,533 (GRCm39)	missense	probably benign	0.00
R1767:Chd1	UTSW	17	15,990,565 (GRCm39)	missense	probably damaging	1.00
R1938:Chd1	UTSW	17	15,982,748 (GRCm39)	missense	probably benign	0.39
R2007:Chd1	UTSW	17	15,951,268 (GRCm39)	missense	probably damaging	1.00
R2069:Chd1	UTSW	17	15,962,556 (GRCm39)	missense	probably damaging	1.00
R3771:Chd1	UTSW	17	17,594,913 (GRCm39)	missense	probably damaging	1.00
R3773:Chd1	UTSW	17	17,594,913 (GRCm39)	missense	probably damaging	1.00
R3849:Chd1	UTSW	17	15,952,133 (GRCm39)	missense	probably damaging	1.00
R4241:Chd1	UTSW	17	15,990,289 (GRCm39)	nonsense	probably null
R4242:Chd1	UTSW	17	15,990,289 (GRCm39)	nonsense	probably null
R4354:Chd1	UTSW	17	17,610,263 (GRCm39)	missense	probably benign	0.23
R4469:Chd1	UTSW	17	15,980,657 (GRCm39)	missense	probably damaging	0.99
R4731:Chd1	UTSW	17	17,598,079 (GRCm39)	missense	probably benign	0.36
R4824:Chd1	UTSW	17	15,953,386 (GRCm39)	missense	probably damaging	1.00
R4840:Chd1	UTSW	17	15,989,016 (GRCm39)	missense	probably damaging	1.00
R4840:Chd1	UTSW	17	15,989,015 (GRCm39)	nonsense	probably null
R4880:Chd1	UTSW	17	17,594,916 (GRCm39)	missense	probably damaging	1.00
R4960:Chd1	UTSW	17	15,962,493 (GRCm39)	missense	probably damaging	0.96
R5071:Chd1	UTSW	17	15,982,667 (GRCm39)	missense	probably benign
R5078:Chd1	UTSW	17	15,946,616 (GRCm39)	missense	possibly damaging	0.93
R5114:Chd1	UTSW	17	15,948,460 (GRCm39)	missense	probably benign	0.25
R5268:Chd1	UTSW	17	15,956,005 (GRCm39)	missense	probably damaging	1.00
R5304:Chd1	UTSW	17	15,990,530 (GRCm39)	missense	possibly damaging	0.55
R5304:Chd1	UTSW	17	15,975,213 (GRCm39)	missense	probably benign	0.01
R5307:Chd1	UTSW	17	15,952,832 (GRCm39)	missense	probably damaging	1.00
R5458:Chd1	UTSW	17	15,958,811 (GRCm39)	missense	probably damaging	1.00
R5553:Chd1	UTSW	17	17,605,875 (GRCm39)	missense	probably benign	0.17
R5623:Chd1	UTSW	17	15,975,194 (GRCm39)	missense	probably damaging	1.00
R6022:Chd1	UTSW	17	17,598,035 (GRCm39)	missense	probably benign	0.39
R6137:Chd1	UTSW	17	15,978,950 (GRCm39)	missense	probably damaging	1.00
R6257:Chd1	UTSW	17	15,950,465 (GRCm39)	splice site	probably null
R6373:Chd1	UTSW	17	15,958,898 (GRCm39)	missense	probably damaging	1.00
R6458:Chd1	UTSW	17	15,950,864 (GRCm39)	missense	probably benign	0.01
R6476:Chd1	UTSW	17	17,601,250 (GRCm39)	critical splice donor site	probably null
R6508:Chd1	UTSW	17	15,958,895 (GRCm39)	missense	probably benign	0.31
R6553:Chd1	UTSW	17	15,945,692 (GRCm39)	missense	probably benign	0.00
R6745:Chd1	UTSW	17	17,607,429 (GRCm39)	missense	probably benign	0.08
R7107:Chd1	UTSW	17	15,981,628 (GRCm39)	missense	probably damaging	0.98
R7230:Chd1	UTSW	17	15,927,199 (GRCm39)	splice site	probably null
R7317:Chd1	UTSW	17	15,962,536 (GRCm39)	missense	possibly damaging	0.71
R7341:Chd1	UTSW	17	15,990,499 (GRCm39)	missense	probably damaging	0.99
R7421:Chd1	UTSW	17	15,969,660 (GRCm39)	missense	probably benign	0.03
R7704:Chd1	UTSW	17	15,987,737 (GRCm39)	missense	probably benign
R7763:Chd1	UTSW	17	15,953,303 (GRCm39)	missense	probably damaging	1.00
R8156:Chd1	UTSW	17	15,981,666 (GRCm39)	missense	probably benign
R8194:Chd1	UTSW	17	17,594,737 (GRCm39)	start gained	probably benign
R8261:Chd1	UTSW	17	17,607,804 (GRCm39)	missense	probably benign	0.02
R8338:Chd1	UTSW	17	15,990,242 (GRCm39)	missense	probably damaging	1.00
R8401:Chd1	UTSW	17	15,963,473 (GRCm39)	missense	probably damaging	1.00
R8411:Chd1	UTSW	17	15,982,711 (GRCm39)	missense	probably damaging	0.98
R9067:Chd1	UTSW	17	15,951,107 (GRCm39)	missense	possibly damaging	0.49
R9184:Chd1	UTSW	17	15,962,551 (GRCm39)	missense	possibly damaging	0.71
R9210:Chd1	UTSW	17	15,950,767 (GRCm39)	missense	possibly damaging	0.70
R9212:Chd1	UTSW	17	15,950,767 (GRCm39)	missense	possibly damaging	0.70
R9666:Chd1	UTSW	17	15,955,976 (GRCm39)	missense	probably damaging	1.00
R9673:Chd1	UTSW	17	15,989,023 (GRCm39)	missense	probably benign	0.24
Z1176:Chd1	UTSW	17	15,988,995 (GRCm39)	missense	probably damaging	1.00
Z1176:Chd1	UTSW	17	15,986,609 (GRCm39)	missense	probably damaging	0.98
Z1177:Chd1	UTSW	17	15,968,063 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCTCTTGTAGTTTATGACATAGCC -3'
(R):5'- TAAACTGTACACGTCTGGCCTC -3'

Sequencing Primer
(F):5'- GCCTATTCTTCCAACAATATTAGGAG -3'
(R):5'- GGCCTCTCTCTACAGTCATAACTAGG -3'

Posted On

2015-07-21